Answered: Assuming human cells have on average…

Name: Assuming human cells have on average 1000 mitochondria, what percentag
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Assuming human cells have on average 1000 mitochondria, what percentage by weight of the total DNAisolated from human tissue would be mtDNA?

Science

Biology

Assuming human cells have on average 1000 mitochondria, what percentage by weight of the total DNAisolated from human tissue would be mtDNA?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 2QP: Why do you think nucleic acids were originally not considered to be carriers of genetic information?

See similar textbooks

Related questions

Q: Does Phospodiester bonds hold deoxyribose and phosphate components together in the DNA

A: Ans- true

Q: Which of the following is correct according to the DNA base-pairing rules? O a. A= G O b. A= C O c.…

A: Nucleotide bases are arranged in a proper sequence. There are four nucleotide sequences out of which…

Q: TRUE OR FALSE a) In a dsDNA, a pyrimidine in one chain is always paired with a purine on the other…

A: DNA is a very important biomolecule as it is responsible for storing all the genetic information and…

Q: The letter R isconventionally used to represent anypurine base (A or G) and Y to represent…

A: Purines and pyrimidines are the two families of nitrogeneous base that are used to make nucleic…

Q: why the human dna is considered as a fibonacci sequence?

A: A Fibonacci Sequence is where each number is the sum of two preceding numbers, like…

Q: How many fragments are produced if ddT is added to the following DNA segment during Sanger…

A: DNA is arranged in a specific sequence of nucleotides. The sequence consists of four types of…

Q: If you assume the average length of a DNA linker region is 50 bp,approximately how many nucleosomes…

A: The eukaryotic chromosome is made of half DNA and half proteins, from proteins, one half is the…

Q: Name three intermolecular forces that stabilize the shape ofbDNA, and explain how they act.

A: The three inter molecular forces that stabilize the shape of DNA are: 1) Nitrogen bases form…

Q: How many different dna fragments would you expect to obtain if you cleaved human genomic dna with…

A: The cell is the fundamental unit of life. The nucleus part of the cell contains Deoxyribonucleic…

Q: -PBR322 DNA (4.32 kb) was cleaved with HindIII nuclease and lig- ated to a HindlII digest of human…

A: Restriction Endonucleases cleave DNA to smaller fragments. These DNA fragments are cloned into new…

Q: Extracting DNA From Strawberries Is isopropyl alcohol polar or nonpolar? Explain

A: DNA extraction is used to isolate dna molecule from the cells . It helps in removing impurities and…

Q: Clearly, all humans have variations in their DNA sequences. How is it possible to sequence the human…

A: Answer- All the organism have certain amount of similarities in the DNA sequnece. In all the human…

Q: How many units (U) of EcoR1 did you use in the digestion? How much lambda DNA (in ugs) was digested…

A: DNA-cutting enzymes are restriction enzymes. Each enzyme recognises a single or a few target…

Q: Some bacteria possess antibiotic resistance, as well as the ability to survive through adverse…

A: Bacteria They are small prokaryotic organisms with cell wall except some. Bacteria are both useful…

Q: the one above: Replicate this sense strand to create a double-stranded DNA helix…

A: DNA is a double helical structure containing complementary base pairs. Complementary base pairs…

Q: A medium-sized human chromosome contains about 100 millionbp. If the DNA were stretched out in a…

A: → Given that , human chromosome medium-sized containsabout 100 million np base pairs.each turn has…

Q: Calculate the length of the DNA of bacteriophage lambda that has 48502 base pairs.

A: Introduction: DNA stands for deoxyribonucleic acid and is a form of nucleic acid. Except for a few…

Q: In modern molecular genetics, what is recombinant DNA, and how is it prepared?

A: Deoxyribonucleic acid (DNA) is the genetic material that carries genetic information in the form of…

Q: Is it biologically advantageous that DNA is stable?

A: DNA (deoxyribonucleic acid) is a double helical twisted ladder-like structure that stores and…

Q: Ъ. Why are some of the bands of DNA fragments thicker (brighter) than the others?

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Approximately how many base pairs were identified in the human genome working drafts?

A: The human genome project is a scientific project led by James Watson and Francis Collin, started in…

Q: What are the exceptions to the general rule that DNA is the genetic material in all organisms? What…

A: The exception is that RNA is the genetic material in some organisms. Many viruses have been shown to…

Q: What would be a medical advantage of having a catalog of SNPs?

A: A single-nucleotide polymorphism is a substitution of a single nucleotide at a unique position in…

Q: The following double stranded DNA fragment was double digested with BamHI and Kpnl. If you ran the…

A: Restriction enzymes are the enzymes which cut the DNA at specific sequences. The specific sequence…

Q: The text stated that molecular biologists have developed elegant techniques that can convert any…

A: A gene is a sequence of nucleotides in genome that codes for a functioning molecule. There is a…

Q: TRUE or FALSE a) The deoxyribose connects to N9 of guanine. b) In a dsDNA, a pyrimidine in one…

A: Purines and pyrimidines are nitrogen-containing aromatic compounds. They are the major components of…

Q: Given our knowledge of genome sizes in different organisms, would you predict that Homo sapiens or…

A: The hereditary material that transfers from one generation to another present in the nucleus of the…

Q: If the analysis of DNA from two different microorganismsdemonstrated very similar base compositions,…

A: The genetic material of bacteria and all the microorganisms is DNA which is comprised of nitrogenous…

Q: If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is…

A: The genome is the entire DNA content (in base pair) of a haploid (n) cell. That means in case of a…

Q: If the amino acid sequences of monkeys and humans in the protein of two organisms are similar, why…

A: Amino acids Amino Acids are known as building blocks of proteins. There are many different kind of…

Q: What are the consequences for a DNA sequencing reaction if the ratio of dideoxyribonucleoside…

A: Introduction DNA is composed of nucleotides arranged in a specific sequence. Prior knowledge of DNA…

Q: How do we know that DNA also serves as the genetic material in eukaryotes such as humans?

A: DNA is the genetic material in our cells. they contain genetic information that controls our…

Q: What key structural features of the DNA molecule underlie its ability to be faithfully replicated?

A: DNA is known as deoxyribonucleic acid. DNA is the genetic material in humans and other organisms.…

Q: What part(s) of a nucleotide (namely, phosphate, sugar, and/orbase) is(are) found in the major and…

A: Nucleotides are composed of a phosphate group, a pentose sugar, and a nitrogenous base. The pentose…

Q: In addition to correcting DNA mismatches, themismatch repair system functions to prevent…

A: Mutations are usually defined that they are supped to refer to changes or alterations that occur in…

Q: Why is mtDNA important?

A: Mitochondria also are known as a powerhouse because it helps to release energy from food.…

Q: Escherichia coli and other bacteria methylate adenines on the original strand to distinguish the…

A: When growing a cell divide, they need to copy their genetic material and distribute it to ensure…

Q: What is a DNA library? Do you think this name is appropriate?

A: In terms of molecular biology, a library can be defined as the collection of DNA fragments that are…

Q: Would you be more likely to find single nucleotidepolymorphisms (SNPs) in the protein-coding or in…

A: Single nucleotide polymorphisms in short SNPs refer to the variation in a single base pair that…

Q: The human genome is approximately 3 billion basepairs in size.a. Using standard 8.5″ × 11″ paper…

A: "Since you have posted a question with multiple questions, we will solve the first question for you.…

Q: Given the Percentage Composition of One Nucleotide ina Genome, Can We Predict the Percentages of the…

A: Nucleotides are the chemical compounds that constitute the nucleic acids. The nucleic acids are of…

Q: Approximately how many Okazaki fragments are synthesized in thereplication of the human genome?

A: Okazaki fragments are short sequences of DNA nucleotides, which is synthesized during replication…

Q: What is the significance of the fact that more of the DNA is in slower-moving forms?

A: DNA (deoxyribonucleic acid) is known as molecule that include the genetic code of organisms.

Q: This image shows DNA (gray) interacting with a computergenerated model of a TAL protein…

A: Xanthomonas is a gram negative bacterium, which can affect a wide range of plants like rice, pepper,…

Concept explainers

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.

Topic Video

Question

Assuming human cells have on average 1000 mitochondria, what percentage by weight of the total DNA
isolated from human tissue would be mtDNA?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps with 1 images

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

why the human dna is considered as a fibonacci sequence?
What part(s) of a nucleotide (namely, phosphate, sugar, and/orbase) is(are) found in the major and minor grooves of doublestrandedDNA, and what part(s) is(are) found in the DNA backbone?If a DNA-binding protein does not recognize a specificnucleotide sequence, do you expect that it binds to the majorgroove, the minor groove, or the DNA backbone? Explain.
Using the straight-chain sugar convention where the vertical lines represent sugars and the diagonals are phosphodiester bonds, choose the correct structure of the DNADNA strand that encoded this short stretch of RNA. pppApCpUpGpGpCpApA−OH
Does Phospodiester bonds hold deoxyribose and phosphate components together in the DNA molecule? true or false?
Choose the correct gel electrophoretic pattern that would be seen in dideoxy sequence analysis of the DNADNA molecule shown below. pGGCGACCGATTAGTCCCATCGATGGG−OH
TRUE OR FALSE a) In a dsDNA, a pyrimidine in one chain is always paired with a purine on the other chain because of this arrangement, the molecule is 2nm wide along its entire length. Example is A with G or C with T. b) The helical turns of the DNA does not only provide spaces for binding with regulatory proteins but they cause the molecule to resemble a spiral staircase.
The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how much more or less frequently than random do they occur?
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
In addition to correcting DNA mismatches, themismatch repair system functions to prevent homologousrecombination from taking place between similar but notidentical sequences. Why would recombination betweensimilar, but nonidentical sequences pose a problem forhuman cells?
If you assume the average length of a DNA linker region is 50 bp,approximately how many nucleosomes can be found in the haploidhuman genome, which contains 3 billion bp?
What is the significance of the fact that more of the DNA is in slower-moving forms?
Let’s assume the linker region of DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?