How many units (U) of EcoR1 did you use in the digestion?How much lambda DNA (in ugs) was digested by EcoR1 in the digestion? TUBEECORIVORTEXA DNABUFFERH2OВАМНIHINDIII1 sec"B"1 pl2 µl16 µl1 pl1 sec"H"1 pl2 ul16 ul1 pl1 sec1 µl"E"1 ul2 ul16 µl1 sec"1 pl2 ul17 ul三三

DNA-cutting enzymes are restriction enzymes. Each enzyme recognises a single or a few target…

Answered: How many units (U) of EcoR1 did you use…

How many units (U) of EcoR1 did you use in the digestion? How much lambda DNA (in ugs) was digested by EcoR1 in the digestion?

Curren'S Math For Meds: Dosages & Sol

11th Edition

ISBN:9781305143531

Author:CURREN

Publisher:CURREN

Chapter10: Reconstitution Of Powdered Drugs

Section: Chapter Questions

Problem 17SST

See similar textbooks

Related questions

Q: A researcher has isolated a restriction endonuclease that cleaves at only one particular 10-…

A: Restriction endonuclease is an enzyme which cleaves DNA into fragments at specific location sites…

Q: Below is a sequence of DNA.…

A: Introduction :- Adenine (A), thymine (T), cytosine (C), and guanine (G) are four nucleic acid bases…

Q: The restriction enzyme Alu I cleaves at the sequence 5’-AGCT- 3' , and Not I cleaves at 5'…

A: Restriction enzymes or restriction endonucleases are endonuclease enzymes capable of recognizing a…

Q: How many bases, or letters, are in the human genome?

A: To determine the whole sequence of nucleotides in the human genome, the HGP was initiated in 1990.…

Q: How often, on average, would you expect a type II restriction endonuclease to cut a DNA molecule if…

A: Restriction endonucleases are enzymes produced by bacteria that cut the DNA at a specific site known…

Q: How many different dna fragments would you expect to obtain if you cleaved human genomic dna with…

A: The cell is the fundamental unit of life. The nucleus part of the cell contains Deoxyribonucleic…

Q: If you have a given amino acid, can you be able to identify its RNA? Why or why not?

A: The protein is made up of amino acids and it is the final product of a gene. It determine the…

Q: Assume that a DNA sequencing reaction is carried out, except that the four different…

A: Ans: DNA sequencing: It is the process of knowing the sequence of the DNA. The DNA sequencing is of…

Q: Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving…

A: Genomic Libraries are a set of collections of genomic DNA data particular to a species/organism. The…

Q: Assuming human cells have on average 1000 mitochondria, what percentage by weight of the total…

A: The mitochondrial DNA (deoxyribonucleic acid) is 16.6 kilobase pair long that contains 37 genes. It…

Q: When aligning the three sequences (ATGC, AATC, AATG), one can use a 3-D "Manhattan Grid", with each…

A: ANSWER: ATG-C AAT-C AA-TG

Q: A particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base…

A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…

Q: What does SDS–PAGE stand for? What is the benefit of doing SDS– PAGE?

A: Electrophoresis is the migration of charged particles under the influence of an electric current.…

Q: The A+T: G+C ratios in DNA of cattle and rat are very similar. Would you expect the tRNA, rRnas, and…

A: Chargaff's rules state that DNA from any species of any organism should have a 1:1 protein…

Q: The following double stranded DNA fragment was double digested with BamHI and Kpnl. If you ran the…

A: Restriction enzymes are the enzymes which cut the DNA at specific sequences. The specific sequence…

Q: What is the principle behind the very specific sequence in donning and doffing PPEs? Explain

A: PPE -- refers to the personal protective equipments which help against the spread of infection and…

Q: In the Meselson and Stahl experiment, what part of the DNA gets labeled with 15N? Why?

A: Introduction: The main experimental proof for the semiconservative DNA replication was given by…

Q: What are the sequences of all the possible tripeptides that contain the amino acids, serine, leucine…

A: The polypeptide is made up of amino acid residues, which are joined by the peptide bond.

Q: If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is…

A: The genome is the entire DNA content (in base pair) of a haploid (n) cell. That means in case of a…

Q: If the amino acid sequences of monkeys and humans in the protein of two organisms are similar, why…

A: Amino acids Amino Acids are known as building blocks of proteins. There are many different kind of…

Q: On the basis of current knowledge, the protein-encoding regions account for only about 3% of the…

A: The Central Dogma of molecular biology states that: DNA makes RNA, which makes Proteins. However, a…

Q: You prepare a reaction mix containing (i) DNA polymerase II, (ii) DATP, dCTP, DGTP, Mg2+, and…

A: DNA replication is considered a process, during which new strands are synthesized.

Q: The E. coli genome is 4.6 Mbp (mega base-pairs). What is the physical length of the E. coli genome?

A: In this question, we are given the size of E.coli genome which is 4.6 mega base pairs. 4.6 mega base…

Q: If pET32a(+) is digested simultaneously with BamHI and BclI, 1.How many fragments are created? 2.…

A: Cells contain nucleic acid which stores essential genetic information for the survival of the cell.…

Q: By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 =…

A: Answer :- For the first question, the restriction site for the enzyme Sau3a is composed of four…

Q: In the human genome for the beta chain of haemoglobin (the oxygen-carrying protein in the red blood…

A: Hemoglobin present in red blood cells helps in the transport of oxygen molecule to and from various…

Q: If you compare the frequency of the sixteen possible dinucleotide sequences in the E. coli and human…

A: CG directly activates pDCs and B cells. The resultant immune response is characterized by the…

Q: What part(s) of a nucleotide (namely, phosphate, sugar, and/orbase) is(are) found in the major and…

A: Nucleotides are composed of a phosphate group, a pentose sugar, and a nitrogenous base. The pentose…

Q: The DNA of a deletion mutant of λ bacteriophage has a length of 15.4383 μm instead of 19.6356 μm.…

A: The mutation is the change in the nucleotide base pairs or in the DNA sequence which can be because…

Q: What is Kozak sequence ? who invented this ?

A: Introduction The process of transcribing the mRNA into protein is called Translation. There are 3…

Q: The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to…

A: Transcription is the molecular process of synthesis of RNA from DNA. The genetic code of DNA is…

Q: The human genome is approximately 3 billion basepairs in size.a. Using standard 8.5″ × 11″ paper…

A: "Since you have posted a question with multiple questions, we will solve the first question for you.…

Q: Given the Percentage Composition of One Nucleotide ina Genome, Can We Predict the Percentages of the…

A: Nucleotides are the chemical compounds that constitute the nucleic acids. The nucleic acids are of…

Q: Approximately how many Okazaki fragments are synthesized in thereplication of the human genome?

A: Okazaki fragments are short sequences of DNA nucleotides, which is synthesized during replication…

Q: For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides…

A: Transcription is the DNA dependent RNA synthetic process. RNA polymerase help in the transcription.…

Q: a. What type of nucleic acid and from what species would the scientist use to begin construction of…

A: a. answer... the scientist uses chromosomal DNA to begin the construction of her genomic DNA…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…

A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…

Q: How many fragments would you expect to be formed from digestion of a 2500 base pair long linear…

A: Given information: 2500 base pair long linear piece of DNA is the piece of DNA that is to be worked…

Q: What is the E-value of the sequence, what does your E-value reflect and what’s the importance of an…

A: Bioinformatics is the branch of science that deals with the genome, gene, and protein sequences. It…

Q: Suppose you are a research assistant in a lab studying dna-binding proteins. you have been given the…

A: Amino acids are the organic compounds that acts as the building block of protein molecules. Proteins…

Q: (a) Is it biologically advantageous that DNAis stable? Why or why not? (b) Is it biologically…

A: The two major types of nucleic acids are DNA and RNA. They are made from nucleotides, containing a…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

How many units (U) of EcoR1 did you use in the digestion?
How much lambda DNA (in ugs) was digested by EcoR1 in the digestion?

TUBE
ECORI
VORTEX
A DNA
BUFFER
H2O
ВАМНI
HINDIII
1 sec
"B"
1 pl
2 µl
16 µl
1 pl
1 sec
"H"
1 pl
2 ul
16 ul
1 pl
1 sec
1 µl
"E"
1 ul
2 ul
16 µl
1 sec
"
1 pl
2 ul
17 ul
三三

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

TRUE OF FALSE: Is E coli colonies would be pink mucoid in Eosin Methylene BlueAgar (EMBA)? Is Coliform colonies would be pink mucoid in Eosin Methylene BlueAgar (EMBA)?
plse cansomeone help determine the stain. name and duration for this bacteria.
In Figure 5-5,a. Why do A− and B− cells, by themselves, not formcolonies on the plating medium?b. What genetic event do the purple colonies in themiddle plate represent?
You counted 4, 6, 12, 3 cells in each of the 4.outed squares of a hemacytomeyer. What are the cells per milliliter in that culture? If you resuspended your cell pellet 2.5 mL, what is the total cell count? How many uL do you need to add to a new culture if you want 4250 cells?
Why does nigrosin not stain the bacteria?
5 μL of plasmid DNA (pUC 19) was added to 50ul of CaCl2 competent E. coli that was then added 250 μL of SOC medium, 100 μL of this solution was plated onto a TSA + ampicillin plate. Can you please show me how I calculate the total number of successful transformants per mL of competent cells plated. The total number of colnies counted on plate was 70. Thank you
45years old male had been working e his garden when he scratched the knuckle of his right aram during digging in ground with a spade,he immediately washed the area but noticed that the knuckle became red,warm to the touch and swollen.he went to hospital,the doctor ordered a hram stain and culture on the pus extracted from the wound. Which culture grew?
Bacteriophage A average = 136 plaques Bacteriophage B average = 38 plaques Bacteriophage C average = 27 plaques Please help find the PFU/ml and answer the question on the best bacteriophage. Thanks
hello can you draw the capsule staining of Escherichia coli in 1000x objective
did i identify sample a correctly? or is it actually none?
What is the Description and uses of these type of microsope?Explain in 2-3 sentencesDescription:Uses: a. Bright Fieldb. Phase Contrastc. Fluorescenced. Confocale. Transmission EMf. Scanning EM
45years old male had been working e his garden when he scratched the knuckle of his right aram during digging in ground with a spade,he immediately washed the area but noticed that the knuckle became red,warm to the touch and swollen.he went to hospital,the doctor ordered a hram stain and culture on the pus extracted from the wound. As a microbiologist describe what you can see in on the gram stain taken from the wound site.give a priliminary report on what you can see on culture plates.what is prbable genus and species? Name 2 tests that can be done to positively identify this organism. What are the media used to culture the sample ,and what type of hemolysis seen?