Assuming you have determined the sequence of a certain enzyme/protein product, how will you identify its correct DNA sequence (*some codons are redundant or wobbled) using the cDNA library?
Q: Which amino acid(s) have the most codons? Which amino acid(s) have the fewest codons? Can you think…
A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…
Q: In this chapter, we considered a computer program that translates aDNA sequence into a polypeptide…
A: Translation is a process in which the conversion of DNA sequence into amino acid sequence takes…
Q: Considering prokaryotes, what is the enzyme that links the tRNA molecules to its correct or cognate…
A: Ans- tRNA molecules serves as the link between the amino acid form of proteins and the genetic code…
Q: If you know the sequence of amino acids in a protein, what does the genetic code table allow you to…
A: Amino acids are the building blocks of proteins. Proteins serve as structural support inside the…
Q: Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If…
A: DNA replication being very complex process, there are chances of miss reading the DNA template and…
Q: Explain how it is possible that some tRNA molecules recognize more than one codon
A: Introduction: The process of translation involves the synthesis of the polypeptide chain with the…
Q: How would you choose where to begin your reading of a sequence in mRNA? Which rule governing the…
A: The translation is the process by which polypeptide chain (protein) is produced from the mRNA…
Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…
A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…
Q: Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about…
A: Introduction: 20 amino acids make up all the proteins. These are the building blocks of proteins…
Q: if a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV…
A: The molecular weight of a Protein can be accurately predicted if the amino acids making up the…
Q: m
A: DNA → RNA RNA → protein
Q: What is the consensus sequence of the following six DNA…
A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…
Q: sequence belo - Indicate the start site for translation by underlining the start codon. - Translate…
A: mRNA sequence 5' GUAGUCAUGCCCGACGCAUUUACGAUUCAGUGACUG 3'. The codons are triplet in nature and the…
Q: Refer to a genetic code table for the question. below is a portion of the template strand of a…
A: The genetic code is a set of three-letter combinations of nucleotides called codons, each of which…
Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…
A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…
Q: For translation, identify two things that happen during each step - initiation, elongation and…
A: Translation is a complex process it is the final formation of protein with the help of m RNA, t RNA…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An R-loop refers to a structure formed by a DNA (deoxyribonucleic acid) and an RNA molecule. As a…
Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…
Q: In protein biosynthesis, the first codon of the new amino acid chain corresponds to: a. C…
A: The codons are triplets of nucleotides present in the mRNA sequence. There is a total of 64…
Q: How many possible open reading frames (frameswithout stop codons) exist that extend through the…
A: In molecular genetics, an open reading frame (ORF) is the part of a reading frame that has the…
Q: Discuss the following statement: “from the nucleotide sequence of a cDNA clone, the complete amino…
A: The proteins are the polymer of amino acids. They play an important role in the cell, by catalyzing…
Q: Assuming the genetic code is a triplet, what effect would the addition or loss of two nucleotides…
A: The process in which the messenger ribonucleic acid (mRNA) molecule sequence is translated to form…
Q: A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP.…
A: Introduction: The process in which RNA is synthesized from DNA is known as transcription. Therefore,…
Q: Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it…
A: Ribosomes are present in both plant and animal cells. they are present in both prokaryotic and…
Q: Can the same enzyme esterify more than one amino acid to its corresponding tRNA?
A: Aminoacyl transferases are the enzymes which are responsible for the attachment of the main acid to…
Q: Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom…
A: The process of protein synthesis using the information in an organism's DNA is called central dogma…
Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…
A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…
Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: If a tRNA anticodon is CAA what is its corresponding mRNA codon? For the genetic code which amino…
A: Genes that provide instructions for proteins are expressed in a two-step process i.e., by…
Q: Why can one not reliably predict the sequence of nucleotides onmRNA or DNA by observing the amino…
A: The amino acids on a protein are coded for by codons on the mRNA, which in turn was transcribed from…
Q: A tRNA anticodon has the base sequence CCG. Identify the DNA base sequence that was used to produce…
A:
Q: Suppose that codons consisted of 4 nucleotides instead of 3 and that there were only 2 different…
A:
Q: If a TRNA anticodon was GUG, which amino acid would the tRNA carry? Below is a partial genetic code…
A: TRANSLATION It is the process of formation of a polypeptide chain by joining of various amino acids.…
Q: Which of the following enzymes has 5' to 3' exonuclease activity?
A: 5’ to 3 ‘ exonuclease activity is the ability to remove nucleotides by enzymes. The nucleotides are…
Q: How can you identify the start codon in the mRNA sequence ?
A: mRNA sequence During the process of translation, mRNA is read on the basis of genetic code that…
Q: A triplet code with three nucleotides per codon is the most efficient way to encode the 20 different…
A: Nucleotides are the building block of nucleic acid whereas amino acids are the building blocks of…
Q: - Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…
A: mRNA contains coding regions (exons) and non-coding regions (introns). The introns are removed by…
Q: The template strand of a double helical segment of DNA consists of the following sequence:…
A: DNA is composed of nucleotides and it is a double-stranded helical molecule, and each of nucleotide…
Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…
A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…
Q: Consider this nucleotide sequence of DNA strand in the image provided. If this strand is the sense…
A:
Q: Does lysyl-tRNA synthetase have a proofreading capability? If so, what are other amino acids can you…
A: The translation is considered as the process, in which polypeptide is synthesized with the help of…
Q: In studying the mechanism of a particular enzyme, for which the cloned gene is available, you wish…
A: Site-directed mutagenesis is the molecular biology technique that alters the sequence of the target…
Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’, what is the sequence of the…
A: EXPLANATION: DNA utilizes four bases, adenine (A), guanine (G), cytosine (C), and thymine (T), in…
Q: If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the…
A: DNA strand – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…
Q: a molecular geneticist hopes to find a gene in human liver cells that codes for an important…
A: As given in the question, there is a particular gene in the human liver cells that quotes for an…
Q: Which amino acid is at the beginning of every eukaryotic protein and why?
A: The genetic information is transferred from DNA to RNA and from RNA to protein. This flow of genetic…
Q: If there are 64 codons, how can there be fewer than 64 tRNA molecules?
A: An adapter molecule made of RNA, generally 76 to 90 nucleotides in length (in eukaryotes), that acts…
Assuming you have determined the sequence of a certain enzyme/protein product, how will you identify its correct DNA sequence (*some codons are redundant or wobbled) using the cDNA library?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- What sequence information about a gene is lackingin a cDNA library?If you know the sequence of amino acids in a protein, what does the genetic code table allow you to infer about the sequence of base pairs in the gene that specifies that protein?In this chapter, we considered a computer program that translates aDNA sequence into a polypeptide sequence. Instead of runningthis program, a researcher could simply look the codons up in agenetic code table and determine the sequence by hand. What arethe advantages of running the program rather than doing the translationthe old-fashioned way, by hand?
- Suppose that codons consisted of 4 nucleotides instead of 3 and that there were only 2 different bases. How many amino acids could be encoded by this variant of the genetic code?Suppose the codon sequence AUGACCCGGCUACUG has a single base pair mutation to AUGACCCGGUUACUG. If the old protein sequence was Met-Thr-Arg-Leu-Leu, what will be the new sequence encoded by the mutant gene?How can you identify the start codon in the mRNA sequence ?
- If the genetic code used 4 bases at a time, how many amino acids could be encoded?Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. five
- Suppose the codon sequence GUGCAAUUCGAGGCC has a single base pair mutation to GUGCAAUUCAAGGCC. If the old protein sequence was Val-Gln-Phe-Glu-Ala, what will be the new sequence encoded by the mutant gene? ____________________________.Based on these sequences. Remove codons 24 to 66, inclusive. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGIf a bacterial protein is 3,300 amino acids long, how many nucleotidepairs long is the gene sequence that codes for it?