Answered: Imagine if there were 200 commonly…

Imagine if there were 200 commonly occurring amino acids instead of 20. Given what you know about the genetic code, what would be the shortest possible codon length? Explain.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter15: From Dna To Protein

Section: Chapter Questions

Problem 1ITD

See similar textbooks

Related questions

Q: how many codons would exist in a genetic code that was four bases long (instead of three)

A: DNA consists of four different bases, and the codon is four bases long. So, there will. be 44 number…

Q: Discuss why the genetic code is said to be degenerate.

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…

Q: Explain how it is possible that some tRNA molecules recognize more than one codon

A: Introduction: The process of translation involves the synthesis of the polypeptide chain with the…

Q: What does it mean when we say that the genetic code contains degeneracy? Discuss the universality of…

A: After the process of Transcription, when a small segment of DNA is transcribed into a strand of…

Q: Explain why cell biologists predicted that the genetic code would be based on a 3-base codon.…

A: The genetic code is the precise sequence of DNA nucleotides read as three-letter words or codons…

Q: How would you choose where to begin your reading of a sequence in mRNA? Which rule governing the…

A: The translation is the process by which polypeptide chain (protein) is produced from the mRNA…

Q: The figure represents tRNA that recognizes and binds a particular amino acid (in this instance,…

A: Your answer is incorrect and the correct answer is 5'-UUC-3' This is because the amino acid…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: People used to think that the genetic code could be found in proteins, because there are so many.…

A: Genetic code It is defined as the set of rules through which the information in the genetic material…

Q: Include a complete nucleotide monophosphate structure, draw the adenine-uracil basepair that would…

A: Nucleotides monophosphate are basic building blocks of nucleic acids (DNA and RNA). it is consist of…

Q: Using a table that shows which codon represents which amino acid determine the following: A)…

A: The three nucleotide sequence either DNA or RNA is called codons.During protein synthesis, it codes…

Q: Degeneracy of the genetic code denotes the existence of which of the following? A. codons that can…

A: Characteristic of genetic code: - The genetic code is a triplet (first suggested by Gamow in 1954).…

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: Nucleus is the genetic centre of the cell. It contains hereditary and genetic information stored in…

Q: The nearly universal genetic code consists of how many codons?

A: Genes are the unit of heredity and they are made up of triplet genetic codons. These codons are…

Q: Consider a portion of a gene in a cell with the sequence TTTTT. Which of the following bases would…

A: The correct answer is C) A-A-A-A-A; nucleus .

Q: then translate the resulting mRNA using the gentic code table below. Choose the correct sequence of…

A: The flow of genetic information in cells from DNA to messenger RNA ( mRNA) to protein is identified…

Q: List a few exceptions to the genetic code.

A: A gene is a unit of genetic material present on the strand of DNA (Deoxyribonucleic acid). DNA…

Q: Exon shuffling is a proposal that relates exons in DNA to the repositioning of functional domains in…

Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…

A: The mRNA is "read" by the genetic code during translation that constitutes the second major stage in…

Q: Suppose that section x, y, and z of the following hypothetical DNA strand are the exon (coding…

A: Exons and introns are nucleotide sequences within a gene. Exons are the coding sections of a gene…

Q: How many bases would a mRNA have? if it was coded for a protein of 250 amino acids long? explain…

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Discuss why you think the ribosomes need to contain so many proteins and rRNA molecules. Does it…

A: Ribosomes are present in both plant and animal cells. they are present in both prokaryotic and…

Q: The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains…

A: The process of formation of mRNA(messenger ribonucleic acid) molecules on the DNA(deoxyribonucleic…

Q: If the DNA triplet is TTA, then the transcribed MRNA codon would be

A: All living organisms store their genetic information in form of DNA / RNA. This genetic information…

Q: Why could a codon not consist of only two bases?

A: The genetic information of DNA is based on the nucleotide base sequences. These sequences are…

Q: In how many cases in the genetic code would it NOT be possible to know the amino acid specified by a…

A: DNA or deoxyribonucleic acid is a double-helical molecule consisting of two polynucleotide chains.…

Q: The sequence of a polypeptide is determined by the order of codons that specify the amino acids in…

A: Proteins are the ultimate products of the genes. DNA is transcribed into m RNA and this is…

Q: NASA sends a mission to Mars that brings back a new life form! It is carbon-based and its genetic…

A: Mars is an obvious source of inspiration for science fiction. It is common and well-read, yet unique…

Q: Suppose that codons consisted of 4 nucleotides instead of 3 and that there were only 2 different…

Q: Figure 3 represents one process that occurs during protein synthesis. amino acid - molecule Q A UGC…

A: Note - Since you have posted a question with multiple sub-parts, we will solve the first three…

Q: If a mutation changed the start codon into a stop codon, would this mutation affect the length of…

A: Mutations are the changes in the base sequences of the nucleotides in a gene. They are known as gene…

Q: Create protein sequence with 10 elements. (Start with a codon and ends with a stop codon)

A: Protein sequencing is the cycle of deciding the amino acid arrangement of all or part of a protein…

Q: During planetary exploration a new life form is discovered which has a DNA genome containing 6…

A: Hereditary qualities is a part of science related to the investigation of genes, hereditary variety,…

Q: A triplet code with three nucleotides per codon is the most efficient way to encode the 20 different…

A: Nucleotides are the building block of nucleic acid whereas amino acids are the building blocks of…

Q: Look at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) Ser

A: Codons are the triplet base of the nucleotide sequence, which encodes the amino acids during…

Q: Explain what is meant when we say the genetic code is degenerate.

A: The genetic code is the set of rules used by living cells to translate information encoded within…

Q: Explain the relationship between codons, anticodons, and amino acids. Be sure to define each and use…

A: Amino acids are organic compounds which are composed of amine and carboxyl group.Main elements…

Q: Analyze the following amino acid sequence and write down a potential mRNA sequence from which this…

A: The translation is a process by which ribosomes in the endoplasmic reticulum synthesize proteins…

Q: Explain the reasoning establishing that a sequence of three nucleotides (a triplet codon) is the…

A: The nucleotide can be defined as the basic building block of nucleic acids. RNA and DNA can be…

Q: Using the example above, transcribe the following DNA strand into mRNA and translate that strand…

A: During transcription, the enzyme RNA polymerase uses DNA as a template to produce a pre-mRNA…

Q: Which of the following statements are accurate descriptions of the genetic code? MARK ALL THAT APPLY…

A: Transcription is the process in which the mRNA copied information from DNA for protein synthesis.…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: Using the genetic code table, find the sequence of amino acids coded by the 2 DNA sequences (documi…

A: Transcription is the process by which the genetic information in the DNA segment is copied into an…

Q: The codons in the genetic code are sequences of three bases. Explain why sequences of only two bases…

A: In general it is explained that DNA is comprised of 4 different nucleotides (A, C, T, and G),…

Q: If there are 64 codons, how can there be fewer than 64 tRNA molecules?

A: An adapter molecule made of RNA, generally 76 to 90 nucleotides in length (in eukaryotes), that acts…

Concept explainers

Viral Replication

The virus is acellular and considered non-living outside the host cell. The replication of the virus occurs only inside the living cells. Only a few genes are present in the smallest virus, whereas many genes are present in the largest virus. These genes encode specific viral proteins.

Question

Imagine if there were 200 commonly occurring amino
acids instead of 20. Given what you know about the
genetic code, what would be the shortest possible codon
length? Explain.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
How many codons would exist in a genetic code that had codons that were four bases long? Why? (show the equation for calculation)
Suppose that codons consisted of 4 nucleotides instead of 3 and that there were only 2 different bases. How many amino acids could be encoded by this variant of the genetic code?
how many codons would exist in a genetic code that was four bases long (instead of three)? DRAW and Show your work.
Look up a standard genetic code table, how many codons will be recognized by tRNA charged by lysyl-tRNA synthetase, then explain the degeneracy of genetic code observed by including the Wobble hypothesis. Please provide sources for your answer.
NASA sends a mission to Mars that brings back a new life form! It is carbon-based and its genetic material is similar to Earth DNA except that it uses 6 different nucleotide bases instead of 4. Its proteins are also similar to those on Earth, but there are 60 different amino acids instead of 20. In order to study this new life form further, the National Science Foundation asks you for your ideas about the genetic code for this organism. How many spaces would you propose are in each codon of the genetic code for this new organism? Why?
What is genetic code? How many codons are there? Justify that genetic code is universal
Use this genetic code table for some of the questions ahead. You do not need to memorize the code, except for the start codon (AUG = Met) and the stop codons (UAA, UAG, UGA). Which of the following statements about the genetic code is correct? A) All codons specify more than one amino acid. B) The genetic code is redundant. C) All amino acids are specified by more than one codon. D) All codons specify an amino acid.
Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that would be repli-cated from this one.b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.c. State how many codons the sequence specifies.d. State how many amino acids the sequence specifies
Look at Table 26.3 and find codons for the following amino acids:(a) Val (b) Arg (c) Ser
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? a. complementarity b. nonsense codons c. universality d. degeneracy
Codons are a three-letter genetic code that encode for specific amino acids. Which amino acid is at the beginning of every eukaryotic protein and why?