Below is a 6 base sequence of DNA. What type of mutation would result if the fourth nucleotide base T from the 3' end was changed to an A? 3' САTTСT 5'
Q: ONA sequences have an alphabet {A, C,G,T}. How many DNA sequences of length n are there? (Two DNA…
A: Dna is a nucleic acid polymer made of deoxyribonucleotides. It is a bit like a string of letters…
Q: According to Chargaff's observations of nucleotide composition of DNA samples OA % of (G + C) + % of…
A: Chargaff's rule has been stated for the DNA, which states that the ratio of purine and pyrimidine…
Q: If the sequence of bases in one strand of DNA is 5′ TAGCCT 3′,then the sequence of bases in the…
A: Answer is c.) 3'ATCGGA5'.
Q: Which of the following sequences would be complementary to a DNA strand with the sequence…
A: Complementarity refers to a relationship between two structures each following lock and key…
Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…
A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…
Q: Chargaff studied the composition of DNA from different sources and found that a. the number of…
A: A gene is a fundamental unit of heredity and a succession of nucleotides in DNA or RNA that encodes…
Q: Which of the following statements are correct? explain your answers.A. A DNA strand has a polarity…
A: A.The statement: A DNA strand has a polarity because its two ends contain different bases is false…
Q: Which of the following represents a missense mutation in the DNA coding strand sequence, 5' -…
A: A change in the structure of DNA, known as a mutation, can alter the sequence of amino acids that…
Q: The diagram shown below represents an incomplete section of a DNA molecule. The boxes represent…
A: DNA is a double helical structure that is composed of nucleotides. Each nucleotide consists of a…
Q: What kind of DNA damage is depicted in this picture: HN H20 HO ar g O strand breakage O base…
A: DNA damage is a change in the basic structure of DNA that is not itself replicated when the DNA is…
Q: The Watson and Crick model of DNA structure shows
A: The Watson and Crick model of DNA structure shows how the two strands of DNA are arranged to form a…
Q: One nucleotide strand of a DNA molecule has the base sequence illustrated below. 5′ –ATTGCTACGG–3′…
A: Deoxy ribonucleic acid (DNA) is the genetic material of most organisms that carry coded genetic…
Q: How does DNA differ from RNA with respect to the following characteristics? a) number of chains b)…
A: Single-celled organism to complex multicellular plants and animals make up the diversity of life on…
Q: Which of the following is a characteristic of DNA sequences at the telomeres? a. One strand consists…
A: Chromosomes are long thread-like structures that carry coded genetic information in the form of DNA.…
Q: Given the graph, how big would a fragment of DNA be that travelled 20mm on a gel? 10000 Boco 4000…
A: In this graph Y axis is the size of DNA fragment in base pair. And X axis is the distance travelled…
Q: Which of the following best explains the production of Okazaki fragments in replicating DNA (a) DNA…
A: Okazaki fragments also known as lagging strand in DNA replication is a strand whose RNA primers are…
Q: which type of base pairs uf any allow the dna to remain double dtranded at higher temperature? gc…
A: DNA is the main store house of genetic information in our body. DNA condensed to form chromosome,…
Q: Segments of DNA act as templates that guide the amino acids to join together to form a. proteins.…
A: DNA => Transcription => mRNA => Translation => Protein.
Q: Which of the following is false about the types of DNA? A. Z-DNA is right handed double helix. B.…
A: Nucleic acids are the organic materials present in all organisms in the form of DNA or RNA. Nucleic…
Q: AKS 5a: Which of the following combinations is true of the nucleotide composition of a sample of…
A: According to Chargaff's rule, DNA of organisms should have 1:1 stoichiometric ratio of pyrimidine…
Q: A-DNA is a double-stranded form of DNA that has a helical radius and helical pitch compared to the…
A: Biological macromolecules are those large molecules that are necessary for the survival and growth…
Q: You analyse some DNA using an automated sequence reaction. The first peak you observe is labeled…
A: Given: You analyse some DNA using an automated seqyence reaction. The first peak you observe is…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A:
Q: Given the following sequence for one strand of a double-strand oligonucleotide: 5’ACCGTAAGGCTTTAG3’…
A: Nucleus is main controller of the cell which carries genetic instructions . It contain Chromosome…
Q: What type of chemical bonds hold together a DNA double helix? weak hydrogen bonds between…
A: DNA It is one of nucleic acid that constitutes two polynucleotide chains. These chains coil around…
Q: Figure 1 shows a DNA base sequence. It also shows the effect of two mutations on this base sequence.…
A: Given DNA bases: A T T G G C G T G T C T The amino acids of the DNA triplets are also given.
Q: You have this sequence of DNA from leading strand: GGCATGCGA From this you know: * O G is the 5'end…
A: DNA acts as genetic material in all living organisms. During replication of DNA, at each replication…
Q: The A and B forms of DNA A both have 12 base pairs per turn of the helix B are both right handed…
A: DNA or deoxyribonucleic acid is a polymer made up of nucleotides. It is present in a double-stranded…
Q: A linear piece of DNA is cut as follows: cut with Ecorl - get 1kb and 4 kb band Cut with Bamhl - get…
A: Ans- According to question For linear DNA – Upon Cutting by for Eco R1 it formed – 1kb and 4kb =…
Q: The two DNA chains are held together by complementary base pairing between A and T bases and between…
A: DNA are made of Nucleotides . A phosphate group, a sugar group, and a nitrogen base are all found in…
Q: One strand of a DNA molecule has the base sequence 5’-CACTTA-3’. The complementary base sequence on…
A: Deoxyribonucleic acid (DNA) is defined as an organic chemical molecule that will contain all the…
Q: What property/characteristics can definitely be concluded from the given composition of a DNA? A =…
A:
Q: Which of the following pairs of base sequences could form ashort stretch of a normal double helix of…
A: Deoxyribonucleic acid (DNA) is the hereditary material present in humans and almost all organisms.…
Q: Which kind of chemical damage is depicted in this picture: IN H,N NH3 SARA NH DNA DNA Selar Base…
A: Base deletion is a type of mutation in which a base is deleted from DNA. Strand breakage is a…
Q: Not all DNA conforms to the Watson and Crick's model because Z-DNA twists in the left-hand direction…
A:
Q: Select the options that describe the correct pairings of the nitrogen bases in the DNA molecule.…
A: DNA is a nucleic acid that is a polymer of nucleotides that includes a nitrogenous base, a pentose…
Q: Which of the following pairs do not match? O DNA has an antiparallel : direction with 5'-phosphate…
A: DNA is composed of nucleotides which are composed of nitrogenous bases, a pentose sugar, and…
Q: If the ratio of (A+G)/(T+C)=0.7 in one strand of the DNA, what is the same ratio in complementary…
A: Step 1 There are two types of nucleic acids, deoxyribonucleic acid or DNA and ribonucleic acid or…
Q: The sequence below is one strand from a double-stranded DNA molecule. How many hydrogen bonds hold…
A: In a double-helix, DNA is made up of two strands of nucleotide or nitrogenous bases which are…
Q: Which of the following DNA has a high G-C content? (Tm refers to the melting temperature of the DNA.…
A: In double stranded DNA the adenine binds with thymine and guanine binds with cytosine. This four…
Q: DNA before and after mutation. Which of on. Which of the following are CORRECT about the types of…
A: Mutation is the change in the nucleotide of the DNA sequence which ultimately affects the Amino acid…
Q: unknown coding strand of the DNA can be easily determined. G A T с ||_ |||||| | || <|||| | |_|| | ||…
A: Introduction There are two types of nucleic acids are present in our body, DNA and RNA. DNA acts as…
Q: When DNA is copied, sometimes a mutation can occur where an incorrect, base pairing appears within…
A: In biology, a mutation is an alteration in the nucleotide sequence of the genome of an organism,…
Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…
A:
Q: Consider the following DNA molecule: ACG GTACACTTAC GA A T GCCAT G T GA A TG CTT 1) Draw the 2…
A: DNA stands for deoxyribonucleic acid. It is a nucleic acid, a polymer of nucleotides. A nucleotide…
Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B=3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…
A: A hairpin loop has a stem that contains complementary bases and a circular structure that does not…
Q: A strand of DNA has the sequence 5'-AGTC-3'. What is the sequence of the complementary strand in the…
A: The DNA has two strands which are comprised of nucleotides- A stands for adenine, T stands for the…
Q: Below is a nucleotide base pair from B-DNA with three different regions indicated by A, B, and C. C…
A: If we represent the nitrogen base as a triangle, there are going to be three edges: Hoogstein Edge:…
Q: Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting…
A: In this question, we are given a coding strand of DNA which has undergone mutation from *G* to A. A…
Q: orange G (yellow) bromophenol blue (purple) xylene cyanol (blue)
A: Gel electrophoresis is a laboratory method used to separate mixtures of DNA, RNA, or proteins…
Do question 38
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Shown below is a DNA coding strand. A base (*G*) mutates to Adenine (A). What will be the resulting amino acid sequence as a result of the mutation? What type of mutation occured? Hint: Determine the template, then first determine the amino acid sequence before the mutation, and then determine the amino acid sequence after the mutation. Show how you got your answer. 5' T-A-C-T-T-C-C-A-*G*-C-C-G-C-T-C 3'If the first G changes to A what kind of mutation will happen? Show the change in amino acid sequence. This is base substitutions involve the replacement of one nucleotide with another. And it changes one amino acid coding, producing a missense mutation TAC CTA GCA CAC ATGTAGGTGGGCAAAGTT TAC CTA ACACACATGTAGGTGGGCAAAGTT1. Below is an amino acid sequence for the following strand of DNA:A G C A A T C C G T C T T G GT C G T T A G G C A G A A C CThat strand has mutated. It is nowA G C A A C C C G T C T T G GT C G T T G G G C A G A A C CUse your knowledge of mutation and protein synthesis to answer the following questions.What mutation has occurred? A. point mutation B. movement of large section of chromosome C. duplication of entire chromosome D. genetic recombination 2. Will this mutation have a real effect? Why or why not?
- Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on the other half? A. CGATTCCGCAATAGGGG B. GCTAAGGCGTTATCCCC C. CGATGCCGCAATAGGGG D. ATAGGAATACCGCTTTT E. TATCCTTATGGCGAAAAThe following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group B - MUTATION 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C- 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’
- The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features – capitalization does not affect the nucleotide indicated. 5’…atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc…3’ a. Underneath that strand write the sequence of the strand of DNA it would be paired with in a doublestranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, U-uracil and C-cytosine and remember to label the 5’ and 3’ ends. b. Next, write the sequence of a possible mRNA transcript of the double stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5’ and 3’ ends. c. Using the genetic code, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein below the mRNA sequence in (b) and label the amino and carboxy terminals d. Suppose the bracketed, bold [a] were mutated to be a t. Write the new sequence of your mRNA transcript…Which of the following sequences on a DNA moleculewould be complementary to GCTTATAT?a. TAGGCGCGb. ATCCGCGCc. CGAATATAd. TGCCTCTCThe following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all groups and translate. FIND THE POSSIBLE MUTATIONS Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
- The sequence below shows one strand of DNA. Parts of the sequence are in capital letters to help you identify important features - capitalization does not affect the nucleotide indicated. 5' ...atacaATGcATGTCAaCTAcg[a]agatccgTAGaTAACATtCATatc...3' a) Underneath that strand, write the sequence of the strand of DNA it would be paired with in a double-stranded helix. Use the single letter code A-adenosine, G-guanosine, T-thymine, C-cytosine, and U-uracil, and remember to label the 5' and 3' ends b) Next, write the sequence of a possible mRNA transcript of the double-stranded DNA above. Remember that an mRNA must be translatable by a ribosome into a protein. Be sure to indicate 5' and 3' ends c) Using the genetic code at the end, translate your mRNA into the appropriate protein. Write the amino acid sequence of the protein using the single letter amino acid code (also at the end) below the mRNA sequence in (b) and label the amino and carboxy terminals d) Suppose the bracketed bold [a] were…Which of the following sequences is the best description of the complementary DNA sequence to the following sequence: 5'-CGATTAGC-3' Group of answer choices 5'-GCTAATCG-3' 5'-GCUAAUCG-3' 3'-CGATTAGC-5' 3'-GCUAAUCG-5' 3'-GCTAATCG-5'One strand of a DNA molecule has the base sequence 5’-CACTTA-3’. The complementary base sequence on the other strand of DNA will be 3’-_____-5’. A. GTGAAT B. GUGAAU C. UTUGGT D. TGTAAG