ONA sequences have an alphabet {A, C,G,T}. How many DNA sequences of length n are there? (Two DNA sequences are the same if one is he rexerse of the other)

Q: Below is a sequence of DNA.…

A: Introduction :- Adenine (A), thymine (T), cytosine (C), and guanine (G) are four nucleic acid bases…

Q: Base nitroɡen DNA pair which are have 2 bond of H₂ inside of them?

A: A nucleotide is formed by nitrogenous base, sugar and phosphate. DNA is made up of polymer of…

Q: Hydroxylamine (NH2OH) converts cytosine to the compound shown below. With which base does this…

A: Transition mutation refers to a point mutation that changes a purine nucleotide to another purine or…

Q: Which of the following sequences is most likely to form a beta-turn? Explain why?…

A: The majority of proteins are globular in form. Thus, forming, turning, bending, or reorienting is…

Q: Which of the following is correct according to the DNA base-pairing rules? O a. A= G O b. A= C O c.…

A: Nucleotide bases are arranged in a proper sequence. There are four nucleotide sequences out of which…

Q: le) Frrors may occur during DNA replication, resulting in a change to the sequence of base triplets.…

A: Through the replication process, the information from one DNA molecule is replicated to create two…

Q: The Universal Genetic Code Table can be used to determine the gene product of a given nucleotide…

A: mRNA consist of mononucleotide sequence that specifies amino acids sequence in peptide chain. One…

Q: In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures…

A: Cruciform DNA is a form of non-B DNA that requires at least a 6 nucleotide sequence of inverted…

Q: You are analyzing the region of DNA shown below to determine how many AATG repeats are present. To…

A: In PCR, forward and reverse primers are to  be added. PCR involves denaturation, annealing and…

Q: The following is the base sequence of DNA that codes for first eight amino acids of the β chain of…

A: 1.  Each amino acid corresponds to a codon and each codon is made up of sequence of three nucleotide…

Q: In the actual experiment, the researchers used 149 sequences to buildtheir sequence logo, which is…

A: The sequence logo helps in predicting certain gene features. Gene features such as the ribosome…

Q: How many of each base is found in the complete double-stranded molecule?

A: The concept is based on Chargaff's rule. It is given by Erwin Chargaff to calculate the amount of A,…

Q: How many units (U) of EcoR1 did you use in the digestion? How much lambda DNA (in ugs) was digested…

A: DNA-cutting enzymes are restriction enzymes. Each enzyme recognises a single or a few target…

Q: In a standard procedire, when writing and reading base sequences for nucleic acids (both DNA and…

A:

Q: Calculate the length of the DNA of bacteriophage lambda that has 48502 base pairs.

A: Introduction: DNA stands for deoxyribonucleic acid and is a form of nucleic acid. Except for a few…

Q: Write the complementary sequence of DNA AGCTAT AGC

A: A DNA is a double stranded structure. Both the strands are complementary to each other. Adenine (A)…

Q: Using the straight-chain sugar convention where the vertical lines represent sugars and the…

A: DNA is the genetic material in all living organisms and it is made up of thymine, adenine, guanine,…

Q: Shown are several single stranded DNA sequences written in the 5' to 3' direction. Which of the…

A: A hair pin structure will be formed due to internal base pairing in a DNA molecule.

Q: In the sequence 5'-TCCGGA-3, an available phosphate group would be found at the 5' end of the…

A: Introduction: A nucleotide is an organic molecule that consists of a nitrogenous base, pentose…

Q: 5'-GATTACAATAGGAATTC~~ GAATTCTCGTGACTCCG-3' 3'-CTAATGTTATCCTTAAG~ CTTAAGAGCACTGAGGC-5' Which of the…

A: PCR or polymerase chain reaction is a DNA amplifying technique where a short piece of a gene or a…

Q: Given this sequence ATGCACCG About how often (every _____ bases) would this occur in double strand…

A: All DNA strands are made up of nucleotides namely Adenine (A), Thymine (T),  Guanine (G), and…

Q: The Bacteria Escherichia coli DNA genome has a molecular mass of about 3.1 X 109 In your answers,…

A: The bacterium Escherichia coli, commonly known as E. coli belongs to the family of gram negative…

Q: For the following sequence, what is the Tm? 5'-AGCTACGATCAGGTCA-3'

A: Polymerase chain reaction (PCR) is a technique to amplify the sequence of DNA. A large quantity of…

Q: Are the following base sequences “sticky” (complementary) or not? All sequences are written 5′ to…

A: The purines (adenine and guanine) and the pyrimidine (cytosine, thymine) are the two types of…

Q: Why is it that sometimes you can identify some sequence similarity for protein sequences (i.e.,…

A: Actually BLAST means Basic Local Alignment Search Tool which is a search program used to generate…

Q: ns: In each box, type the hrst letter of the base that correctly matches the given DNA sequences C…

A: Answer. A nucleotide is the monomeric unit of nucleic acids. Nucleic acids are therefore also called…

Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with…

A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple…

Q: (a) Provide the sequence of the DNA complementary to the following strand (please write it in the 3'…

A: Complementary DNA  Complementary DNA (cDNA) could be a DNA copy of a mRNA (mRNA) molecule created by…

Q: A partial amino acid sequence from the tick anti-coagulant protein is:…

A: The genetic code is a set of three-letter combinations of nucleotides called codons that corresponds…

Q: Write the base sequence that would be sticky with the sequence T-A-T-G-A-C-T.

A: Erwin Chargaff discovered the complementary base pair rule. according to the chargeoff base-pairing…

Q: Which of the following base pairs is/are not possible in B-DNA?

A: DNA is present in several different forms, such as A, B, and Z forms. Out of these, the B form is…

Q: 5'-TTAGGGAACCCTCACTGAATGAATGAATG AATGAATGAATGAATGAATGAATGAATGAATGTTTGGGCAAATAAACGCTG-3' Re-type (or…

A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…

Q: When a double-stranded DNA molecule is exposed tohigh temperature, the two strands separate, and…

A: Hi! Thanks for your question. I am answering only the first question, as the image is not given in…

Q: BamHI cut sequence: G//GATCC and each sequence is 250 nucleotides long. How many DNA segments would…

A:

Q: THE MOLECULAR GENETICS OF CYSTIC FIBROSIS The following is the base sequence of DNA that codes for…

A: Introduction  One strand of DNA holds the information that codes for various genes. This strand is…

Q: GTT, AT,GсT стс, Ат, GCс GTT, ATт, сст стс, АТА, СGT T G C CCG CTG, ATA, AC C стт, АТА , С GT GTC,…

A: A primer is a short nucleic acid sequence that provides a starting point for DNA synthesis. A PCR…

Q: If I have a DNA sequence of 5’ ATTGGCCGCA 3’, what is the complementary strand?

A: DNA molecule has got two antiparallel helix or strands winded together.  If we know the sequence of…

Q: The average of a number of closely related but nonidentical sequences is referred to as a(n)…

A: Homologous sequence

Q: THE MOLECULAR GENETICS OF SICKLE CELL ANEMIA The following is the base sequence of DNA that codes…

A: Note: You have asked multiple sub part questions but as per our instructions we are instructed to…

Q: From the above sequence (DNA: ATGGATCCGCTTTAG), what is the amino acid sequence?

A: - Cells decrypt mRNAs by reading their nucleotides in teams of 3, known as codons. Here square…

Q: Below is a sequence of DNA.…

A: Amino acids are the building blocks of proteins. The building blocks of life are amino acids and…

Q: Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it…

A: A heritable genetic change in the genetic material of an organism that gives rise to alternate…

Q: A section of DNA composed of 4750 nucleotide pairs is found to code for 573 amino acids. Calculate…

A:

Q: Would you expect to find nuclear localization sequences(NLSs) in the proteins that make up…

A: A nuclear localization sequence is an amino acid sequence that aids in protein transport (import)…

Q: A single strand of DNA, 24 nucleotides long, with the sequence 5'-TTTCCCgggAAAgggTTTAAAggg-3' is…

A: The given ssDNA would serve as a template strand for the synthesis of a complementary strand to form…

Q: Here is the sequence of a portion of one strand of DNA: 5'-GTCCTAACGACTGATCGT-3' a. What is the…

A: According to the central DNA is converted to RNA (transcription) and RNA to protein (translation).…

Q: AAGTCAAGAAGAAGAAGAAGCC A. The nucleotide sequence above is a STR of how many repeats? B. What…

A: Short Tandem Repeats(STR) or microsatellites or simple sequence repeats(SSR) are short sequences of…

Q: Why can’t a G bind to T?…

A: A, T, G, C, and U (in RNA) are nucleotide base pairs that form hydrogen bonds between them that…

Q: With respect to DNA binding motifs and their characteristics choose the correct answer O A. All DNA…

A: DNA-binding domains (DBD) are protein domains that can fold independently. They have at least one…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.