Below is an image of a basepair and associated ribose rings as viewed down the helical axis in B DNA (black spheres are oxygen atoms; red lines are hydrogen bonds). G1 B1 G2 G4 Identify the base marked as B1. Identify the base marked as B2. B2 adenine thymine G3 Identify the general location (G1-G4) of the minor groove. Identify the general location (G1-G4) of the major groove. G4 G2 > <

Below is an image of a basepair and associated ribose rings as viewed down the helical axis in B DNA (black spheres are oxygen atoms; red lines are hydrogen bonds). G1 B1 G2 G4 Identify the base marked as B1. Identify the base marked as B2. B2 adenine thymine G3 Identify the general location (G1-G4) of the minor groove. Identify the general location (G1-G4) of the major groove. G4 G2 > <

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
Type the matching bases in each DNA sequence. G A T A G C T A G G
Using the straight-chain sugar convention where the vertical lines represent sugars and the diagonals are phosphodiester bonds, choose the correct structure of the DNADNA strand that encoded this short stretch of RNA. pppApCpUpGpGpCpApA−OH
Which of the following does not contribute to the stability of the DNA? A. The presence of hydrogen between nitrogenous bases. B. Presence of the N-glycosidic bond between the nitrogenous base and phosphate group C. Presence of phosphodiester bond between the sugar and phosphate group on the sugar-phosphate backbone. D. Hydrophobic interaction between stacked nitrogenous bases.
Assume that an error is made: adenine and guanine are matched as base pairs. What would be the impact on the structure of DNA? What would be the structural impact if adenine and cytosine were paired?
By average, how many Sau3A (5’GATC3’) sites are there in a 10 kd DNA molecule? (1/4)^6 * 10,000 = 2.44140625 => 2.4 For the above 10 kb DNA, if you use Sau3A to do a complete digestion, you will only get a lot of small fragments ( 200~500 base pairs). What should I do if I want to get larger digested fragments (say 3 to 5 kb) Please answer asap and type your answer and do not copy from anywhere please
In addition to the standard base-paired helical structures, DNA can form X-shaped hairpin structures called cruciforms in which most bases are involved in Watson–Crick pairs. Such structures tend to occur at sequences with inverted repeats. Draw the cruciform structure formed by the DNA sequence TCAAGTCCACGGTGGACTTGC.
Below are 9 possible primer pairs.● Determine which primer pair is the best choice.● Explain why the other primers are not good choices.● Calculate the Tm for each primer. Underline or highlight the region of DNA for the primer pair you chose as the best.Forward 1: 5’ gaaataattttgtttaactttaag 3’ Tm =Reverse 1: 5’ gtttaagacaaaatagtctgg 3’ Tm =Forward 2: 5’ gtaactcagctttcaggtcg 3’ Tm =Reverse 2: 5’ tctcggaatgttgcaacagc 3’ Tm =Forward 3: 5’ agattagcggatcctacctg 3’ Tm =Reverse 3: 5’ atgtgtaatcccagcagcag 3’ Tm =Forward 4: 5’ cattgattatttgcacggcg 3’ Tm =Reverse 4: 5’ aaaatcttctctcatccgcc 3’ Tm =Forward 5: 5’ tccataagattagcggatcc 3’ Tm =Reverse 5: 5’ tgcaagcttggctgttttgg 3’ Tm =Forward 6: 5’ gatcctacctgacgcttttta 3’ Tm=Reverse 6: 5’ aaataatgaattcgagctcggt 3’ Tm =Forward 7: 5’ataaaaaaatcgagataaccgtt 3’ Tm =Reverse 7: 5’aggtcgactctagaggatc 3’ Tm =Forward 8: 5’ctacctgttccatggccaac 3’ Tm=Reverse 8: 5’ ttcgggcatggcactcttg 3’ Tm=Forward 9: 5’ tccataagattagcggatcc 3’ Tm =Reverse 9: 5’…
. While studying the structure of a small gene that was recently sequenced during the Human Genome Project, an investigator notices that one strand of the DNA molecule contains the following: 20 adenine (A) bases 30 cytosine (C) bases25 guanine (G) bases 22 thymine (T) bases How many of each base is found in the complete double-stranded molecule?
State the properties of the Watson-Crick model of DNA in the following categories: a) number of polynucleotide chains b) polarity (strand direction running same or opposite c) bases on interior or exterior of molecule d) sugar/phosphate on interior or exterior of molecule e) which bases pair with which f) right- or left-handed helix
What is the base sequence, specified in the 5′-to-3′ direction, for a segment of newly formed DNA if it was formed using the following template DNA segments? 3′ AATGC 5′ 5′ AATGC 3′ 3′ GCAGC 5′ 5′ GCAGC 3′
Convert each of the following 3′-to-5′ DNA base sequences to 5′-to-3′ DNA base sequences. a. 3′ ATCG 5′ b. 3′ AATA 5′ c. 3′ CACA 5′ d. 3′ CAAC 5′