Below is shown an 8kb region of the human genome, with the proportion of the nucleotides that are identical between the human sequence and the homologous sequence from mouse on the top graph, and the location of sequences mapped from an RNA-sequencing experiment on the bottom graph. Use these data to choose the region (A-E) most likely to contain each element of the gene model descriptions below. M 2000 A B C The 5'-UTR An upstream silencer element 4000 chromosome position (bp) An intron without a conserved function D An intron that contains a regulatory element [Choose ] [Choose ] [Choose ] [Choose ] 6000 E 100 % conservation 8000 RNA-seq

Below is shown an 8kb region of the human genome, with the proportion of the nucleotides that are identical between the human sequence and the homologous sequence from mouse on the top graph, and the location of sequences mapped from an RNA-sequencing experiment on the bottom graph. Use these data to choose the region (A-E) most likely to contain each element of the gene model descriptions below. M 2000 A B C The 5'-UTR An upstream silencer element 4000 chromosome position (bp) An intron without a conserved function D An intron that contains a regulatory element [Choose ] [Choose ] [Choose ] [Choose ] 6000 E 100 % conservation 8000 RNA-seq

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Shown below are several next-generation sequencing reads from a sample you have. Which of the following is the most likely candidate for the original linear piece of DNA present in the sample that created the sequence reads shown below? 5' GGGCATTA 3' 5' TACGAACA 3' 5' ATACCGGGC 3' 5' ACCGTACG 3' 5' AACATACC 3' Question 4 options: 5' ATTAACCGTACGAACATACCGGGC 3' 5' GGGCATTATACGAACAATACCGGGC 3' 5' ACCGGGCATTAACCGTACGAACAT 3' 5' AACATACCGGGCATTAACCGTACG 3' 5' GGCATTAACCGTACGAACATACCG 3' 5' ACCGTACGAACATACCGGGCATTA 3'
Assume 2x108 reads of 75 bps long are obtained from a next-generation sequencing experiment to sequence a human genome. Suppose the length of the human genome is 3x109 bps. What is the depth (i.e., coverage) of the sequencing?
If you have access to the necessary computer software, make asequence file and analyze it in the following ways: What is thetranslated sequence in all three reading frames? What is the longest open reading frame? Is the sequence homologous to any known sequences? If so, does this provide any clues about the function of the sequence?
You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below. 5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region 3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region After several tries, you obtained a beautiful sequencing image as shown here: The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline: Tm is 55 – 60°C. Ensures primer had a appropriate melting temperature for PCR ans sequencing. The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%). A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA. The secondary structure of the primer must be none or weak. No primer dimers (The primer anneals to itself). 3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…
You isolate genomic DNA from brain cells and heart cells and use PCR to amplify the promoter region of gene A, known to be methylated under certain circumstances. To determine which cell type has methylation in this region, you treat the DNA with sodium bisulfite, sequence the regions from both brain and heart cells, and compare to the untreated sequence, as shown below. Untreated: ATCCGGCGACG Brain: ATCCGGCGACG Heart: ATCTGGTGACG Given these results, which cell type would you expect to transcribe MORE "A" mRNA?
In the practical you have been analysing a human genomic library. You know from your calculations that only a small proportion of the human genome is represented, even when the entire class results are considered. Therefore, the chance of finding a particular single-copy gene in your library is very small. Outline a strategy for constructing a genomic DNA library more representative of the entire human genome. You will need to consider alternative vectors and the efficiency of transformation of the bacterial cells.
Suppose that a human genomic library is prepared by exhaustive digestion of human DNA with the EcoRI restriction enzyme. Fragments averaging about 4 kb in length would be generated. Is this procedure suitable for cloning large genes? Why or why not?
If a pair of 10-mer primers are used in a PCR, what would be the number of expected binding sites in a human genomic DNA? (You can use approximate values.)
The period gene of Drosophila melanogaster encodes for a stretch of Thr-Gly repeated in tandem. In natural populations, the three most common alleles encode for 17, 20 and 23 Thr-Gly repeats. The amplification by PCR of the allele encoding for 20 Thr-Gly repeats produces a fragment of 320 bp. Using the same set of primers, what is the size expected when amplifying the 17 Thr-Gly allele? 317 303 314 302 In a certain species of plant loci A, B and C have an additive effect on the colour of the flower. Alleles A, B, and C are dominant and alleles a, b and c are recessive. Knowing that a plant with genotype AAbbCc has a pink flower, which genotype, among the ones listed below, will produce the same phenotype? Aabbcc. aabbcc. AaBbCc. AABBCc. In pea plants, tall (T) is dominant to dwarf (t) and yellow (Y) is dominant to green (y). In a cross of true-breeding tall yellow peas x dwarf green…
A method for detecting methylated CpGs involvesthe use of a chemical called bisulfite, which convertscytosine to uracil but leaves methylated cytosine untouched. You want to know whether a particularCpG dinucleotide at one location in the genome ismethylated on one or both strands in a tissue sample.The genomic sequence containing this CpG is:5’...TCCATCGCTGCA…3’. You take genomicDNA from the sample tissue, treat it exhaustivelywith bisulfite, and then use flanking primers toPCR-amplify the region including this CpGdinucleotide. You then want to Sanger sequence(see Fig. 9.7) the amplified PCR product. a. After you treat genomic DNA with bisulfite, the twoDNA strands will melt into single strands. Why?b. Your answer to part (a) introduces a potential complication, because if you do not account for this result of bisulfite treatment, the PCR primers willnot amplify the DNA. What special considerationswould be necessary when you design your PCRprimers for this experiment? Could one pair…
For the given restriction enzyme: BslI (CCNNNNN^NNGG) i) Approximately how many fragments would result from digestion of the human genome (3 × 109 bases) with the enzyme? ii) Estimate the average size of the pieces of the human genome produced by digestion with the enzyme. iii) State whether the fragments of human DNA produced by digestion with the given enzyme would have sticky ends with a 5′ overhang, sticky ends with a 3′ overhang, or blunt ends. iv) If the enzyme produces sticky ends, would all the overhangs on all the ends produced by that enzyme on all fragments of the human genome be identical, or not? The recognition sequence on one strand for the enzyme is given in parentheses, with the 5′ end written at the left. N means any of the four nucleotides; R is any purine—that is, A or G; and Y is any pyrimidine—that is, C or T. ^ marks the site of cleavage. Note that the recognition sites containing Ys and Rs are not always rotationally symmetrical.
what is the whole-genome shotgun sequencing? Also briefly explain its strategy to assemble the genome sequence.