Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences: 5' CCTATGCAGTGGCCATATTCCAAAGCATAGC 3' 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA? 3. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 4. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for a protein in this mRNA? c. what stop codon is present in this mRNA?

Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences: 5' CCTATGCAGTGGCCATATTCCAAAGCATAGC 3' 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA? 3. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 4. If the RNA synthesized above (item #3) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for a protein in this mRNA? c. what stop codon is present in this mRNA?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding What would be the resulting RNA sequence (written 5′→3′ )?
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA?
In the DNA segment 5′-ATGAGGCATGAGACG-3′(coding strand) 3′-TACTCCGTACTCTGC-5′ (template strand) • What products would be formed from the segment’s replication? • Write the mRNA sequence that would be obtained from the segment’s transcription. • What is the amino acid sequence of the peptide produced from the mRNA?
Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of DNA was transcribed, the resulting messenger mRNA molecule would be: Met-Val-Tyr-Lys 3’ TACGTACG 5’ 3’ TTAACCGGTACG 5’ 3’ UUAACCGGUACG 5’
Given this DNA strand: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Identify the following: mRNA: polypeptide chain:
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′3′ … AACTGT … ATATTA … 5′a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand?
Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT
Given a sequence of a DNA coding strand: 5’-ATGATTATCCTATAG-3’ What is the sequence and direction of the mRNA strand synthesized from this DNA?
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand?