Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?

Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?

Name: Below is the 5’–3’ strand of a double-stranded DNA molecule with the f
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1. If the above DNA strand is the coding (sense) strand and the DNA molecule is tra

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 14QP: How many kilobases of the DNA strand below will code for the protein product?

See similar textbooks

Similar questions

Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the template (antisense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences: 5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is transcribed, what is the correct nucleotide sequence and direction of the RNA formed after transcription? 2. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon, a. how many codons are present in this mRNA? b. how many codons actually code for proteins in this mRNA? c. what stop codon is present in this mRNA?
For a DNA template strand containing the sequence 3'AATTGGCC 5', what is the sequence of nucleotides from the 5' to the 3' end in the mRNA transcript?
The following segment of DNA codes for a protein. The uppercase letters represent exons. The lowercase letters represent introns. The lower strand is the template strand. Indicate the 3’ and 5’ ends of both strands. G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g a G G T T A A C G A T A T T A C C G T t t t a a c C C A G T C C G T t t a g c t G T A T C G A C T G C C c c t a c t C C A A T T 2.Write the pre-mRNA molecule. Indicate the 3’ and 5’ ends. 3. Write the mRNA molecule. Indicate the 3’ and 5’ ends 4. Write the tRNA anticodons corresponding to the codons in the mRNA. 5. Write the sequence of amino acids in the resulting polypeptide.
Give the complimentary DNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Give the RNA strand for the following:ACG TAG CTA GTC AGT CGT AGC Using the provided amino acid table and the RNA strand you created in #2, create the amino acid sequence: Name and explain two different ways in which DNA can be damaged. Once DNA is damaged, can we repair it? If not, what are some possible outcomes from the damaged DNA?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’ 1. If the RNA synthesized above (item #1) is a functional mRNA and all the nucleotides belong to an exon,a. how many codons are present in this mRNA?b. how many codons actually code for proteins in this mRNA?c. what stop codon is present in this mRNA?
Which of the following DNA strands, the top or bottom, would serve as a template for RNA transcription if the DNA molecule were to unwind in the indicated direction? 5′ ACGGACTGTACCGCTGAAGTCATGGACGCTCGA 3′ 3′ TGCCTGACATGGCGACTTCAGTACCTGCGAGCT 5′ ⎯⎯⎯⎯→ Direction of DNA unwinding What would be the resulting RNA sequence (written 5′→3′ )?
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?
If the DNA sequence A-T-T-G-G-C-C-T-A on an informational strand mutated and became A-C-T-G-G-C-C-T-A, what effect would the mutation have on the sequence of the protein produced?
To test whether you understand the processes involved in the Central Dogma of Molecular Genetics, determine what amino acid will be formed from the given DNA strand below: #1: 3’ T A C A T G C C G A A T G C C 5’ #2: 3' T A C T G G C A T A A C A C T 5' Note: Prepare the partner strand of the given DNA. Discuss how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used. Look at the genetic code to know what amino acid will become part of the polypeptide chain.