Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences (all belong to an exon): 5'CCTATGCAGTGGCCATATTCCAAAGCATAGC3' 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is expressed to produce a protein product, however prior to expression, mutation took place where, a. the 15th base was replaced by Guanine. Is the amino acid sequence of the synthesized polypeptide chain altered, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation? b. the 18th base was replaced by Guanine. Is there an effect in the structure and function of the synthesized protein, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation?

Below is the 5'-3' strand of a double-stranded DNA molecule with the following nucleotide sequences (all belong to an exon): 5'CCTATGCAGTGGCCATATTCCAAAGCATAGC3' 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 1. If the above DNA strand is the coding (sense) strand and the DNA molecule is expressed to produce a protein product, however prior to expression, mutation took place where, a. the 15th base was replaced by Guanine. Is the amino acid sequence of the synthesized polypeptide chain altered, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation? b. the 18th base was replaced by Guanine. Is there an effect in the structure and function of the synthesized protein, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 14QP: State the properties of the WatsonCrick model of DNA in the following categories: a. number of...

See similar textbooks

Similar questions

What are the base-pairing rules for DNA? a. A-G, T-C c. A-T, G-C b. A-C, T-G d. A-A, G-G, C-C, T-T
Using Figures 8.7 and 8.9 as a guide, draw a dinucleotide composed of C and A. Next to this, draw the complementary dinucleotide in an antiparallel fashion. Connect the dinucleotides with the appropriate hydrogen bonds. FIGURE 8.9 The two polynucleotide chains in DNA run in opposite directions. The left strand runs 5 to 3, and the right strand runs 3 to 5. The base sequences in each strand are complementary. An A in one strand pairs with a T in the other strand, and a C in one strand is paired with a G in the opposite strand. FIGURE 8.7 Nucleotides can be joined together to form chains caled polynucleotides. Polynucleotides are polar molecules with a 5 end (at the phosphate group) and a 3 end (at the sugar group). An RNA polynucleotide is shown at the left, and a DNA polynucleotide is shown at the right.
How many kilobases of the DNA strand below will code for the protein product?
DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 311. If the above DNA strand is the coding (sense) strand and the DNA molecule is expressed to produce a protein product, however prior to expression, mutation took place where,a. the 15th base was replaced by Guanine. Is the amino acid sequence of the synthesized polypeptide chain altered, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation?b. the 18th base was replaced by Guanine. Is there an effect in the structure and function of the synthesized protein, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion…
Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences (all belong to an exon):5’ C C T A T G C A G T G G C C A T A T T C C A A A G C A T A G C 3’1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 2. If the above DNA strand is the template (antisense) strand and the DNA molecule is expressed to produce a protein product, however prior to expression, mutation took place where,a. the 11th base was replaced by Cytosine. Is the amino acid sequence of the synthesized polypeptide chain altered, as compared when there was no mutation? Specify type of mutation in relation to protein function. Is the base substitution a transition or transversion mutation?b. the 2nd base was deleted. Is there an effect in the structure and function of the synthesized protein? Specify type of mutation in relation to protein function. What type of mutation is demonstrated here?c. Thymine is inserted between the 21st and 22nd gene. Is…
A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a template for DNA replication, which of the following correctly depicts the sequence of the newly synthesized strand in the direction in which it will be synthesized? 5′ TAAGCCATT 3′ 5′ TTACCGAAT 3′ 3′ AATGGCTTA 5′ 3′ TTACCGAAT 5′ 5′ AATGGCTTA 3′
Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'
The template strand of a double helical segment of DNA consists of the following sequence: 5’- GTAGCCTTATCTAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACCATGTATAGTTG-3’ Use the given data to answer the succeeding questions and always indicate (and pay attention to) the DIRECTIONALITY of the strands in your answers. Part I. What is the nucleotide order in the complementary DNA strand? Part 2. What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? Part 3. What will be the overall anticodon sequence in tRNA? Part 4. Following the transitional process, what is the amino acid sequence that will be coded for? Show your answer using ONE-letter amino code starting from N-terminus to C-terminus Part 5. Following translational process, what is the amino acid sequence that will be coded for? Show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus.
Which of the following represents a missense mutation in the DNA coding strand sequence, 5' - AAACCTTTT - 3'? a) 5' - AAACCCTTT - 3' b) 5' - AAACCATTT - 3' c) 5' - AAACGTTTT - 3' d) 3' - AAACCTTTT - 5' e) 5' - AAACCGTTT - 3'
List the DNA bases that will complementary base pair with the following sequence: A-G-C-T-A-C-G
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary DNA strand?