The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’   What is the nucleotide order in the complementary DNA strand

Q: G C T A T A A T G G C A a a a t t g G G T C A G G C A a a t c g a C A T A G C T G A C G G g g a t g…

A: Dna is read in 5 ' to 3 ' direction and the mrna is read by the trna in the form of genetic code by…

Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What mRNA would be produced…

A: Introduction  Genes contains specific nucleotide sequences which can be transcribed into the mRNA by…

Q: hat describes or designates the 3' end of a DNA strand?     a. an available hydroxyl group on the…

A: DNA is a double stranded helical structure.It is made up of nucleotides. Each nucleotide is composed…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: Introduction: DNA is a type of nucleic acid that is present in the nucleus of the cell. It is a…

Q: Give the corresponding strand of the DNA having the sequence of: a. 5’…

A: DNA(deoxyribonucleic acid) is the heredity material for most living organisms. It is composed of…

Q: A small section of bacterial DNA antisense strand has the following nucleotide sequence: GCC CAC…

A: An Antisense DNA strand directed in 5’ to 3’ end is the non-coding DNA strand of a cell which acts…

Q: A DNA strand has the following sequence:   5’-GAACCCGATGGCGATACATTTACCAGATCACCAGC-3’   In which…

A: The deoxyribonucleic acid (DNA) replication involves the multiplication of DNA strands. The DNA is a…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The genetic information of all living organisms (except some viruses) is stored in the cell in the…

Q: What is the sequence of the DNA template strand from which each of the following mRNA strands was…

A: As we know that the DNA carries the information, which is translated into the mRNA and transcribed…

Q: What is the consensus sequence of the following six DNA…

A: DNA or the Deoxyribonucleic acid present in both eukaryotes and prokaryotes are made up of millions…

Q: Choose the correct protein sequence that would result from the following DNA template sequence using…

A: Central dogma is the central cellular process that helps in the conversion of the DNA to m RNA by…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: The DNA is composed of purines and pyrimidines. The purines in DNA are adenine and guanine. The…

Q: Here is a nucleotide sequence: ATGCAAGGTT. Choose the answer that correctly identifies both the type…

A: DNA and RNA are two nucleic acid polymers found in all living cells. Both are made up of nucleotide…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: Melting temperature is the temperature at which a double-stranded molecule of DNA is broken down…

Q: One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the…

A: The central dogma of molecular biology is the metabolic process in which the double-helical…

Q: Reading from left to right, what is the nucleotide sequence on the other strand of DNA in this…

A: Answer :- D) G-G-C-A-T-A-T-G-T-A Double-stranded DNA takes the form of a helix, sort of a ladder…

Q: A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a…

A:

Q: One half of a DNA strand has the following sequence of bases GCTACGGCGTTATCCCC. What would appear on…

A: In a DNA molecule each deoxyribonucleotide is made up of a sugar, nitrogenous base and phosphoric…

Q: If one DNA segment  has the following base composition, 5'-CAGTTAGTCA-3', which of the following…

A: DNA universally has 4 N-bases: Adenine, Thymine, Guanine and Cytosine If the given strand sequence…

Q: 5.1) Do you expect DNA strands 1 and 2 below to have the same melting point? Justify your answer.…

A: As per bartleby guidelines we are only allowed to answer one question. Please post the other…

Q: Write the sequence of reverse compliment chain to this DNA sequence: CGTCCGCCCCGCGAGCACA…

A: Double stranded nucleic acids are formed through hydrogen bonding between complementary nitrogenous…

Q: A template DNA strand coded for the following sequence: CTCAAGTTATGTATGTCCGATTCGCATGCGCT 1) What is…

A: DNA is the genetic material of the cell which gets transcribed into mRNA with the help of RNA…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the…

A: Deoxyribonucleic acid (DNA) is a molecule with two chains of polynucleotides that wrap around one…

Q: A primer is laid down complementary to the DNA sequence TAGCAATCGCA to prime synthesis of a daughter…

A: Answer: Introduction: In living organisms, primers are short strands of RNA or DNA commonly 18-22…

Q: If a given double stranded DNA undergoes enzymatic hydrolysis targeting only the "a" side in the…

A: The hydrolysis is targetting the 3' Carbon of the sugar in the phosphodiester bond. 1st strand…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5'    Q:  Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: There are base pairing rules for writing complimentary DNA strands for a given strand. A pairs with…

A: According to Bartleby guidelines, we are supposed to answer first three subparts in case of multiple…

Q: The following is a template strand of DNA: 3' - ATAGCGTACAAGTGGATT - 5'. What MRNA would be produced…

A: The transcription process enables an enzyme known as RNA polymerase to bind to the DNA and break…

Q: Which of the following feature/s characterize B-form DNA? I. Two antiparallel, polynucleoside chains…

A: The genetic material in most living organisms is present in the form of deoxyribonucleic acids…

Q: A DNA probe with sequence TCAGGCTTCAG would bind most strongly to which of the following DNA…

A: DNA probes are single-stranded DNA segments that are hybridised to indicate the existence of…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: DNA is first transcribed into messenger RNA and then mRNA is translated into protein sequence.

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature formula :  Tm = 4* (G+C) + 2 * (A+T)  Number of G+C = 6  Number of A+T = 20

Q: For the following DNA sequence: 3-CGATACGGCTATGCCGGCATT-5' The the sequence of the complementary DNA…

A: Complimentary base pairing Base pairing take place between a purine and pyrimidine. In DNA, adenine…

Q: The following sequences of DNA would be synthesized using 5′-CAGTTCGGA-3′ as a template: *…

A: DNA is synthesized in 5' to 3' direction.

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: The template strand of a double helical segment of DNA consists of the following sequence: 5’-…

A: Hi! Thank you for the questions. As you have posted questions with multiple subparts, I will be…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature of the DNA is the temperature at which half of the DNA becomes single stranded…

Q: Which of these single strand RNA sequences could form a hairpin secondary structure?     5'…

A: The RNA is usually a single stranded molecule of nucleic acid. In RNA four types of nitrogenous…

Q: Consider the following DNA template:   5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’…

A: Of the two strands of DNA, the template strand or non-coding strand is used for transcribing an mRNA…

Q: If the recognition sequence of the restriction enzyme Hindlll is AAGCTT, then how many covalent…

A: The enzymes that are able to cut the DNA at specific sites are known as restriction enzymes. The…

Q: Draw the complementary DNA strand for the given: 5'-A-T-C-C-G-A-A-T-T-G-3' Draw the complementary…

A: Let us first understand the one letter codes for the given nucleotides: A is Adenine T is Thymine…

Q: If you have got the following DNA templatemolecules, which one of them will require more energy to…

A: The separation of two antiparallel strands of DNA is dependent on GC content of DNA. G is guanine…

Q: The template strand of a double helical segment of DNA consists of the following sequence:…

A: DNA is composed of nucleotides and it is a double-stranded helical molecule, and each of nucleotide…

Q: Here is the nucleotide sequence of an imaginary strand of DNA: 5’ AATTGGCCATGC 3’. If this strand of…

A: DNA (deoxyribonucleic acid) was discovered by Friedrich Miescher. Nucleotides are the structural…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: DNA fragments – DNA is a Deoxyribonucleic acid. It is made up of two polynucleotide chains which are…

Q: 5'-AAGCGGGTGTGAGGAGCGCGGCAGCTCAGGTACCCCCGGCCAGGCGCG-3' 31-TTCGCCCACACTCCTCGCGCCGT…

A:

Q: What is the nucleotide sequence of the DNA strand that is complementary to 5'-GGCGCAACTGTCACAA-3'

A: A nucleic acid sequence is a set of five letters that indicates the order of nucleotides in a DNA or…

Q: If you have got the following DNA template molecules, which one of them will require more energy to…

A: DNA is made out of four unique sorts of nucleotides, in particular, adenine, thymine, cytosine, and…

Q: The following are DNA fragments containing a small gene.  The top strand is the coding strand.…

A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…

Q: A segment of a polypeptide chain is Arg-Gly-Ser-Phe-Val-Asp-Arg. It is encoded by the following…

A: When referring to DNA transcription, the coding strand is the DNA strand whose base sequence…