Write out the sequences of the two conserved elements in the following bacterial promoter. The startpoint of transcription is shown in red. CACTTTACAGCGGCGCGTCATTTGATATGATGC GCCCCGCT

Q: of the ER membrane when a COPII-

A: A continuous membrane system that forms a series of flattened sacs within the cytoplasm of eukaryoti...

Q: Which organism has the highest rate of survival at a young age: a toad, a bird, or a human being?

A: The curves that can be utilized to describe the organisms’ survival rate are survivorship curves. Th...

Q: Directions: Examine the following statements, then decide which evidence of evolution does it suppor...

A: 1. Vertebrata is a sub-phylum of Chordata that is further defined by their bony backbone. As, chorda...

Q: Mutations can sometimes happen in the sex chromosomes. What is the effects if a female has a missing...

A: Answer :- when mutations happen in sex chromosomes then it effects female has missing sex chromosome...

Q: question Occasional articles in the press make criticisms of genetic modification of food organisms,...

A: A. Possible criticisms include: •  Unknown human side effects, such as allergies.   • Antibiotic res...

Q: Please answer fast Gene B codes for purple-colored flowers while the recessive form of the gene (b)...

A: Alleles are the alternative forms of a gene that are located on the same locus of a homologous chrom...

Q: Consider the 5 tasks necessary for cell survival that you learned about in Activity 2. Pick ONE task...

A: Cell survival is the function that requires the least amount of GM-CSF and hence receptor occupancy,...

Q: Since among the 64 codons of mRNA 61 codify amino acids that form polypeptide chains what are the fu...

A: From the above given question we have to show what are the three functions of remaining codons as gi...

Q: The accompanying pedigree is for a trait with 100 percent penetrance. The trait is not necessarily u...

A: An organism possessing identical pairs of genes (or alleles) for a certain trait is called a homozyg...

Q: 1.Chimpanzees and humans appear very much alike because of? *         a. common adaptations to simil...

A: The evolution takes place at a very slow speed where characters keep on accumulating and form new sp...

Q: Create a mind map with the following items as the central topic: Modern fishes

A: Jawless fishes, cartilaginous fishes, and bony fishes fall under the category of modern fishes.

Q: Explain how bacteria may have antiviral abilities.

A: Viruses are acellular microorganisms that require a cell called the host to replicate. They can infe...

Q: Predict the potential impacts of invasive species in communities, and suggestresponses to biological...

A: Invasive species are those that occur outside of their natural range, spread quickly, and harm indig...

Q: he following is not a proper taxon?

A:

Q: State the relevance of quality AMR surveillance data

A:  AMR surveillance stands for Antimicrobial resistance  surveillance.

Q: Some demographers claim that the total world population has already begun to slow, while others disp...

A: Demographic transition is a long term trend that represents the decrease in birth rate and death rat...

Q: How many chromosomes are there in the somatic cells of a newborn boy with: a. The cri-du chat syndro...

A:  Chromosomes are responsible for our inherited characteristics . Any abberation in chromosome no. Or...

Q: stacks of flattened membranes attached to or near ER receive proteins from ER and package them into ...

A: Introduction:  Cell is the basic unit of life. Animals and plants both are composed of several of ce...

Q: Let's Analyze. Please answer the following questions with not more than 5 sentences. 1. If Humans' a...

A: Evolution It refers to the alteration in the heritable characteristics of biological populations ove...

Q: Consider the ventricular cardiomyocyte action potential shown below: a) Which phase of the cardiac m...

A: Answer :: a) Signal transduction pathways translate signals received at the cell's surface into cell...

Q: Ted heats some food just to boiling, and stores some of it immediately in a container which he place...

A: A microorganism, or organism, is a living being of minute size, which might exist in its single-cell...

Q: Identify the parts and its characteristic 3.

A:

Q: A microbiologist identifies a bacterium that is capable of degrading cellulose, lignin, chitin, late...

A: There are several bacteria present which can degrade several waste material and convert them into si...

Q: how single-celled eukaryotes became multicellular organisms

A: The first evolved cell on the earth was a prokaryote.

Q: A cell contains 4 metacentric, 4 acrocentric, and 2 submetacentric chromosomes. Under normal conditi...

A: The chromosome involved in the anomaly are identified by inserting the numbers in parentheses betwee...

Q: Which of the following statements must be backed up with an in-text citation of a published sour A. ...

A: when you add information from a source for reference in your the own text you will include the name ...

Q: How would you distinguish a stem cell from a B cell at the DNA level

A: Introduction: A stem cell is a type of cell that has the unique potential to differentiate into many...

Q: III. Problem solving. Show your computations. Answer questions briefly. A 50.0 ml juice extract is c...

A: The Beer-Lambert Law is defined as: It is a relationship between a substance's absorption of light e...

Q: Suppose that a particular species of vertebrate animal has immunoglobulin heavy-chain genes that inc...

A: ANSWER;-

Q: Spicules are structural elements that is found in sponges that form the skeleton and provide structu...

A: Spicules, or "bricks," are the structural components of a sponge, and each species' forms, sizes, an...

Q: Until the Krebs cycle, aerobic respiration can be described without mentioning oxygen, the chemical ...

A: Oxygen is a very important component of aerobic (oxygen-using) respiration that plays a critical rol...

Q: How many carbon dioxide molecules are liberated after each cycle of the Krebs cycle? For a single gl...

A: Introduction From the above question we have to explain How many carbon dioxide molecules are libera...

Q: P generation P generation Normal Precocious Normal Normal puberty d Рp puberty ? pp puberty d pp pub...

A: The cress between Precocious puberty(P) and normal puberty(p) is a simple meiosis division that prov...

Q: Your patient is HIV+ and is having trouble sticking to their treatment plan. Help them understand wh...

A: HIV drug resistance - when virus replicating continuously even in the presence  of that particular i...

Q: 5. A horse breeder finds that one of the stallions has a genetic defect that affects the motility of...

A: Probability means the chance of occurrence of a certain event when expressed quantitatively. It is a...

Q: What is the function of heterocysts?   Heterocysts are cells in which both photosynthesis and nitrog...

A: Introduction: Heterocyst is the specialized cells found in the eubacteria. it plays an important rol...

Q: Explain how logistic growth, limiting factors, carrying capacity, and otherfundamental concepts affe...

A: An ecosystem is a geographical region made up of living (biotic) and non-living (abiotic) factors th...

Q: 1 Dextral, a right-handed coil, results from an autosomal allele (s*) that is dominant... P generati...

A: Coiling direction of the Snail Shell ( Limnaea ) is characterized by the genotype of offspring 'd mo...

Q: How do nucleotides of mRNA chains encode information for the formation of the amino acids sequences ...

A: From the above question we have to explain How do nucleotides of mRNA chains encode information for ...

Q: The cancer gene ras produces mRNA containing an extra exon that includes a number of UAA codons. Can...

A: Ras genes are genes that make proteins involved in cell signalling pathways that controls cell growt...

Q: (a) What pattern of transmission is most consistent with this pedigree? (1) autosomal recessive, (2)...

A: Answer a - Based on the pattern in inheritance, this condition is X-linked dominant trait. This conc...

Q: A clade is a grouping of species that do NOT share derived traits Group of answer choices True False

A: Species: it is a group of individuals that can interbreed and produce fertile offsprings.  Clade: th...

Q: What happens in a situation where all of the compatibility features were ensured and we still get an...

A: ABO Blood Group System: In the year 1900, an Austrian scientist named Karl Landsteiner discovered th...

Q: What is the function of Coronary arteries ?

A: Coronary arteries are a type of artery which spreads around the entire heart like a network of blood...

Q: give three reasons why the parent and daughter cells after mitosis are identical.

A: Mitosis and meiosis are 2 different types of division of the cell. When people say "cell division," ...

Q: What are d ester linkages of fatty acids?

A: As it is an essential component of lipids found in many living organisms, fatty acids are composed o...

Q: Deontology theory about euthanasia

A: Introduction: Euthanasia is the intentional ending of a person's life in order to relieve pain and s...

Q: 1.What are the mechanisms that produce change in populations across generations? 2. How does natural...

A: The physical and functional unit is usually stated to define as they are known heredity is the gene....

Q: Primers designing for epitope tagging: Design forward and reverse primers to amplify the following g...

A: Primers should generally have the following properties: 1. Length of 18-24 bases. 2. 40-60% G/C cont...

Q: The species Canis Lupus (Gray Wolf) is most closely related to which of the animals listed: Dusicyon...

A: Introduction: In divergent evolution, two or more distinct species share a common ancestor from whic...

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.