If the EcoRI/HindIII (stuffer) fragment cut from the vector is religated back into the vector, the M13F/M13R primers will: O Amplify the stuffer fragment because the primers are designed to complement the plasmid DNA O Not amplify the stuffer fragment because the primers are designed to complement human gDNA The primers you used to PCR amplify your human genomic DNA insert from your bacterial colony were designed to complement (or bind): O plasmid pUC19 O human genomic DNA O your mtDNA O All of the above OC

If the EcoRI/HindIII (stuffer) fragment cut from the vector is religated back into the vector, the M13F/M13R primers will: O Amplify the stuffer fragment because the primers are designed to complement the plasmid DNA O Not amplify the stuffer fragment because the primers are designed to complement human gDNA The primers you used to PCR amplify your human genomic DNA insert from your bacterial colony were designed to complement (or bind): O plasmid pUC19 O human genomic DNA O your mtDNA O All of the above OC

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter14: Biotechnology And Society

Section: Chapter Questions

Problem 8QP: DNA Profiles as Tools for Identification STRs are: a. used for DNA profiles b. repeated sequences...

See similar textbooks

Similar questions

An individuals set of unique _______ can be used as a DNA profile. a. DNA sequence c. short tandem repeats b. SNPs d. all of the above
You want to make a recombinant DNA in which aPCR product amplified from the human genome is inserted into a plasmid vector. The polylinker of thisvector includes recognition sites for the enzymesEcoRI (5′ G^AATTC 3′) and BamHI (5′ G^GATCC3′). (The ^ symbolizes the cut site in the DNA.) PCRprimers that could amplify the fragment of humanDNA are: 5′ GCTACTTCGCGTATTCCA 3′ and5′ CCCAAGTCCTAGCCGATA 3′.a. Describe in detail how these primers would need tobe modified to create a fragment of the human genome flanked by EcoRI sticky ends so that thisfragment could be cloned easily into the plasmidvector. You will need to consider the fact that mostrestriction enzymes, including EcoRI, cannot cutDNA if the restriction site is directly at the end ofthe DNA molecule; the restriction enzyme recognition site must be at least six base pairs distant fromthe end.b. Describe a potential feature of the PCR-amplifiedregion of the human genome that could prevent youfrom using the strategy you described in…
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’
When lambda DNA is cut with HinDIII what is the size in base-pairs of the smallest restriction fragment? A.-564 B.- 125 C.-9416 D.- 23,130
For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
You want to amplify the following sequence of DNA from a gene of interest that you are studying. To do this, you will use PCR. Design a forward and reverse primer. Show where the primers anneal to the template sequence. Template DNA: 5’ ATGACGGAATATAAGCTGGTGGTGGTGG---GGCTGCATGAGCTGCAAGTGTGTGCTCTCCTAA 3’ 3’ TACTGCCTTATATTCGACCACCACCACC---CCGACGTACTCGACGTTCACACACGAGAGGATT 5’ (PLEASE EXPLAIN STEP - BY STEP) Answer : Foward primer 5": Reverse primer 3"
Examine the DNA fragment sequence below. Your job is to design primers for PCR that would be able to amplify this DNA fragment. Design the primers so that they are 7 bases in length. Don’t forget to indicate direction (polarity) of the primers. Also describe where the primer would bind (i.e. top or bottom strand, left or right side of the DNA strand). Please organize your response so that each primer, and associated information, is separated by at least one blank line 5’ - TCCACTTGCTGTGTAGCTAAATCATATAACAG3’ - AGGTGAACGACACATCGATTTAGTATATTGAC
A plasmid has two restriction cut sites for EcoRI and one restriction cut site for HindIII. The plasmid is subjected to PCR, and the region containing the three restriction cut sites is amplified, such that all three sites are present in the resulting amplicon. If the amplicon is incubated with EcoRI, how many fragments of DNA are expected to result from this digest experiment? a. 0 b. 1 c. 2 d. 3 e. 4
Human DNA and a particular plasmid both have sites that are cut by the restriction enzymes HindIII and EcoRI. To make recombinant DNA, the scientist should (a) cut the plasmid with EcoRI and the human DNA with HindIII (b) use EcoRI to cut both the plasmid and the human DNA (c) useHindIII to cut both the plasmid and the human DNA (d) a or b (e) b or c
Entire sequence below needs to be amplified by PCR and subcloned into a plasmid vector. Which of the primer sequences listed underneath is the correct reverse primer. What is the correct sequence 5'ATCTCTATTTAATATTTATGTCTATTTAAGCCTCATATTTAAAGACAGGGAAGAGCAGAACGGAGCCCCAGGCCTCTGTGTCCTTCCCTGCATTTCTGAGTTTCATTCTCCTGCCTGTAGCAGTGAGAAAAAGCTCCTGTCCTCCCATCCCCTGGACTGGGAGGTAGATAGGTAAATACCAAGTATTTATTACTATGACTGCTCCCCAGCCCTGGCTCTGCAATGGGCACTGGGATGAGCCGCTGTGAGCCCCTGGTCCTGAGGGTCCCCACCTGGGACCCTTGAGAGTATCAGGTCTCCCACGTGGGAGACAAGAAATCCCTGTTTAATATTTAAACAGCAGTGTTCCCCATCTGGGTCCTTGCACCCCTCACTCTGGCCTCAGCCGACTGCACAGCGGCCCCTGCATCCCCTTGGCTGTGAGGCCCCTGGACAAGCAGAGGTGGCCAGAGCTGGGAGGCATGGCCCTGGGGTCCCACGAATTTGCTGGGGAATCTCGTTTTTCTTCTTAAGACTTTTGGGACATGGTTTGACTCCCGAACATCACCGACGCGTCTCCTGCTG 3'
Following PCR amplification of a disease gene, you perform sequence analysis using a primer 20 nuclear tides in length. partial results are depicted on the gel below which of the following are true?
A student cloned Claudin 1 (877 bp) gene into pTRE3G-BI-ZsGreen1 (total size is 8905 bp) vector using Not1 and EcoRV restriction sites located at 215bp and 779bp respectively. What is the size of the recombinant plasmid? A) 9782 bp B) 9218 bp C) 10776 bp E) 8028 bp F) None of the answers given