Match each of the following terms with its correct function in gene regulation. Dragged and dropped options on the right-hand side will be automatically saved. For keyboard navigation... SHOW MORE ✓ trans-regulatory factor cis-regulatory factor enhanceosome enhancer promoter M = E ||| E ||| The DNA sequence just upstream of the transcription start site where RNA polymerase Il binds to start transcription. A complex of transcription factors and other proteins that bind to enhancers and RNA polymerase II to activate transcription. Any DNA sequence that regulates transcription of a nearby gene. A DNA sequence that binds regulatory proteins needed to activate transcription. A protein encoded by a different gene that binds to DNA sequences near a gene to regulate its transcription.

Match each of the following terms with its correct function in gene regulation. Dragged and dropped options on the right-hand side will be automatically saved. For keyboard navigation... SHOW MORE ✓ trans-regulatory factor cis-regulatory factor enhanceosome enhancer promoter M = E ||| E ||| The DNA sequence just upstream of the transcription start site where RNA polymerase Il binds to start transcription. A complex of transcription factors and other proteins that bind to enhancers and RNA polymerase II to activate transcription. Any DNA sequence that regulates transcription of a nearby gene. A DNA sequence that binds regulatory proteins needed to activate transcription. A protein encoded by a different gene that binds to DNA sequences near a gene to regulate its transcription.

Name: 6. please match each of the item Match each of the following terms wit
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 6. please match each of the item Match each of the following terms with its correct function in gene regulation.Dragged and dropped options on the right-hand side will be automatically saved. For keyboard navigation... SHOW MORE ✓trans-regulatory fac

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 21QP: Transcriptional regulators are proteins that bind to promoters (the 5-flanking regions of genes) to...

See similar textbooks

Similar questions

You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II and transcription factors would bind From the list given - choose all components that you think are part of a typical eukaryotic gene From the list given - choose all the regulatory sequences that you think would control the expression of this eukaryotic gene From the list given - choose all of the regulatory proteins that would bind the eukaryotic gene to control its expression
The following DNA nucleotides are found near the end of a bacterial transcription unit. 3′–AGCATACAGCAGACCGTTGGTCTGAAAAAAGCATACA–5′ Q. Is this terminator rho independent or rho dependent?
Explain using leucine zipper motifs as an example, how protein-protein interactions between transcription factors containing such motifs can generate diversity in transcriptional activation. Refer to the recognition of DNA elements in gene promoters to justify your answer. Assume transcription factor A binds to DNA element A’, transcription factor B binds to DNA element B’, and so forth.
You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate this complex process, you decide to draw for the class a typical eukaryotic gene/transcription unit with its major regions, such as the promoter regions, where the RNA polymerase II and transcription factors would bind etc…. I need the correct answer please From the list given - choose all components that you think are part of a typical eukaryotic gene
Name the lambda promoters whose expression is regulated by the cro protein. For each promoter you named, is cro an activator or a repressor of transcription from that promoter?
Transcriptional regulation often involves a regulatory protein that binds to a segment of DNA and a small effector molecule that binds to the regulatory protein. Do each of the following terms apply to a regulatory protein, a segment of DNA, or a small effector molecule? A. Repressor B. Inducer C. Operator site D. Corepressor E. Activator F. Attenuator G. Inhibitor
Consider the Rho-dependent terminator sequence 5’CCCAGCCCGCCUAAUGAGCGGCCUUUUUUUU-3’. What affect would a point mutation at any one of the bolded and underlined nucleotides disrupt termination of transcription? Group of answer choices Mutation in one of these nucleotides would disrupt base pairing, preventing the formation of the hairpin and disrupting termination. Mutation in one of these nucleotides would have no affect on base pairing, so the termination hairpin is formed and termination proceeds. Mutation in one of these nucleotides would not disrupt base pairing, but would prevent the formation of the hairpin and disrupt termination. Mutation in one of these nucleotides would disrupt base pairing, but not affect the formation of the hairpin and termination proceeds.
For each of the following transcription factors, explain how eukaryotic transcriptional initiation would be affected if it were missing. A. TFIIB C. TFIIH B. TFIID
Mutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter mutations that increase the transcription rate are termed up-promoter mutations, and those that decrease the transcription rate are termed down-promoter mutations. As shown , the sequence of the −10 site of the promoter for the lac operon is TATGTT. Would you expect the following mutations to be up-promoter or down-promoter mutations? A. TATGTT to TATATT B. TATGTT to TTTGTT C. TATGTT to TATGAT
For each statement about gene expression mechanisms, choose the correct end to the sentence. For each gene, the template strand for transcription is determined by…. The direction of translation is determined by…… The tissue-specificity of protein production is determined by…. choices: a. location of the start codon b. location of the promoter c. direction of polymerization by RNA polymerase d. none of these e. direction of movement of ribosomes f. overall orientation of the chromosome
Mutations in bacterial promoters may increase or decrease the rate of gene transcription. Promoter mutations that increase the transcription rate are termed up-promoter mutations, and those that decrease the transcription rate are termed down-promoter mutations. If the promoter for the lac operon is TATGTT, would the following be uppromoters or downpromoters?A. TATGTT to TATATTB. TATGTT to TTTGTTC. TATGTT to TATGAT
4.1 Name and discuss two transcription regulatory elements that can be found in the figure. (6)4.2. During the activation of eukaryotic transcription the promoter region needs to be accessible for the binding of transcription factors. Describe in detail one of the mechanisms involved in this process.