Paraphrase and add more information "This study will concentrate solely on the molecular characterization of seaweed samples collected on Panglao island inSouth-Central Luzon, Philippines. Molecular data will be limited to DNA sequences, with identification relying heavily on Genbank returns via blastN. The researchers would obtain their samples from the generated database and analyze the DNA barcode of each macroalgae. The researchers would also compare the previous list of discovered seaweeds from Panglao island to generate a new and updated version for this study. The research would no text end outside or to the neighboring islands around Panglao, Bohol. Neither would the researchers add or include specimens that did not appear in the database or originate from Panglao island. The data to be considered would also not discuss or include the entire taxonomic key of each available sample."

Paraphrase and add more information "This study will concentrate solely on the molecular characterization of seaweed samples collected on Panglao island inSouth-Central Luzon, Philippines. Molecular data will be limited to DNA sequences, with identification relying heavily on Genbank returns via blastN. The researchers would obtain their samples from the generated database and analyze the DNA barcode of each macroalgae. The researchers would also compare the previous list of discovered seaweeds from Panglao island to generate a new and updated version for this study. The research would no text end outside or to the neighboring islands around Panglao, Bohol. Neither would the researchers add or include specimens that did not appear in the database or originate from Panglao island. The data to be considered would also not discuss or include the entire taxonomic key of each available sample."

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

Modified true or false. Encode the word true if the statement is correct. If the underline word/s is incorrect, then correct the underlined word/s that makes the statement wrong by encoding the correct answer beside false. Answers must be encoded in capital letters 1. When Grammia incorrupta caterpillars are infected by a parasitoid, they show an increased preference for acidic toxins found in larval food plants, and by choosing to eat these toxic plants when infected, are able to increase survival.
Topic: Isolation of E. coli bacteriophage What would happen if: - the enrichment method in the isolation of bacteriophage was omitted? - the chloroform was not added to the enrichment? - the 0.1 ml lysate-E. coli mix was plated directly on top of the bottom agar?
Expand PCR? Describe the different Steps involved in this technique?
Sequence alignment 1- Define the global and local alignments2- What are the differences between local alignment and global alignment?
Guide Questions: Explain your answer and cite references in APA format. 1. What does mashing do to the fruit? 2. Why did you add detergents? 3. What do you think the ethanol does? Why can't we use room temperature ethanol? 4. To extract DNA from cells, what must you isolate it from in the case of a plant such as strawberry? 5. Look at your container, what do you see in the top portion of the liquid? 6. Is the DNA you extracted is pure? What are the possible impurities? 7. What can we do with the DNA once we have purified it? Discuss different techniques and technologies associated with this. 8. Imagine that there is an E. coli outbreak in your area, and you would like to test the kangkong from your local grocery store. How could you modify this protocol to extract DNA from the kangkong (to identify the species) and check for presence or absence of E. coli.? Keep in mind that (i) E. coli is free-living and not an endosymbiont, and (ii) plant cells are encased in both a cell membrane and…
Whole-exome sequencing (WES) is helping physicians diagnose a genetic condition that has defied diagnosis by traditional means. The implication here is that exons in the nuclear genome are sequenced in the hopes that, by comparison with the genomes of nonaffected individuals, a diagnosis might be revealed. (a) What are the strengths and weaknesses of this approach? (b) If you were ordering WES for a patient, would you also include an analysis of the patient’s mitochondrial genome?
rRNA sequence analysis:a. What are two advantages of using sequence analysis of ribosomal components in determiningevolutionary relatedness of organisms? Please explain why each is an advantage.
General Biology - Help me do this activity, you can read the instructions for clarification, thanks!
Question -Esther is completing her PhD project in bacterial distribution in mangroves and theirbiochemical characteristics. She manages to isolate and identify around 80 differentbacterial species from the various mangrove sites. She preserves the isolates by growingthem on a tryptic soy agar supplemented with sea salt and re-streaks them every week. After8 months she notices that some of the isolates have changed their genetic sequence whencompared to the initially identified sequence. Using a diagram explain what could havehappened to the isolates when she re-streaked them repeatedly and recommend a solutionto prevent this from occurring in the future and give explanation why it is moreadvantageous.
Fill the gap Molecular programming, also known as ........ exploits the information-processing capabilities of nucleic acids to design ....... at the nanoscale.
Sequence1 TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATCAGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTCAACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAGCCAGCCTCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCGACGGTGCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA *edited sequence: 1) according to BLAST what is the probable identity of this sequence? 2) what organism does the sequence probably come from genus and species? 3) what is the E value for this sequence ? 4) what is the accession number for this sequen
Question:- Define, compare, and contrast the utility of microarray and RNAseq while analyzing gene expression levels.