BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
10th Edition
ISBN: 9781305967359
Author: STARR
Publisher: CENGAGE L
expand_more
expand_more
format_list_bulleted
Concept explainers
Videos
Textbook Question
Chapter 9, Problem 7SA
Energy that drives transcription is provided mainly by _______ .
| a.
|
c.
|
| b.
|
d.
|
Expert Solution & Answer
Trending nowThis is a popular solution!
Students have asked these similar questions
The function of the genetic code is toa. promote transcription.b. specify the amino acids within a polypeptide.c. alter the sequence of DNA.d. do none of the above.
After transcription, the molecule that is formed is
a.complementary to part of one strand of DNA.
b.complementary to both strands of DNA.
c.double-stranded and inside the nucleus.
d.identical to an entire single strand of DNA.
Transcription is similar to DNA replication because both processes_______ . a. use the same enzyme b. copy both strands c. require the same nucleotides d. proceed in the 5′ to 3′ direction
Chapter 9 Solutions
BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)
Ch. 9 - A chromosome contains many different gene regions...Ch. 9 - A binding site for RNA polymerase is called a...Ch. 9 - An RNA molecule is typically _________ ; a DNA...Ch. 9 - RNAs form by ______ ; proteins form by ________ ....Ch. 9 - Prob. 5SACh. 9 - Prob. 6SACh. 9 - Energy that drives transcription is provided...Ch. 9 - Most codons specify an _________ . a. protein c....Ch. 9 - Anticodons pair with _______ . a. mRNA codons c....Ch. 9 - What is the maximum number of amino acids that can...
Ch. 9 - _______ are removed from new mRNAs. a. Introns c....Ch. 9 - Where does transcription take place in a...Ch. 9 - Where does translation take place in a eukaryotic...Ch. 9 - Energy that drives translation is provided mainly...Ch. 9 - Put the following processes in order of their...Ch. 9 - Prob. 16SACh. 9 - Researchers are designing and testing antisense...Ch. 9 - An anticodon has the sequence GCG. What amino acid...Ch. 9 - Each position of a codon can be occupied by one of...Ch. 9 - Prob. 4CTCh. 9 - Translate the sequence of bases in the previous...Ch. 9 - Prob. 6CT
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.Similar questions
- Addition or deletion of bases causes which kind of mutation? Select one: a. Frameshift mutation b. Transversion c. Transition d. Transcriptionarrow_forwardA single template strand of a DNA molecule is represented by 3’atgtaccatgcgcaaatttaaaggccc5’. a) Imagine that AAG is an INTRON in the original DNA template strand above. Write the mature mRNA strand after the three modifications? b) Write the amino acid sequence of your mature mRNA. c) List the molecules involved in translation and briefly describe their function.arrow_forwardA promoter is ______. a. a specific sequence of DNA nucleotides b. a specific sequence of RNA nucleotides c. a protein that binds to DNA d. an enzyme that synthesizes RNAarrow_forward
- Which statement regarding UTRs is TRUE? a) Transcription begins at the start of the 5' UTR b) Translation begins at the start of the 5' UTR c) The 5' and 3' UTRs are spliced from the mRNA transcript d) The translation stop codon is found downstream of the 3' UTRarrow_forwardIn Eukaryotes, DNA is a long molecule inside a tiny nucleus. a. How can this long chain fit in such space? b. How does it affect gene expression?arrow_forwardTranscription factors a. help the RNA polymerase bind DNA b. are involved in chromatin remodeling, uncoil the DNA c. modulate transcription from the distance d. add the 5’ CAP to the RNAarrow_forward
- At what point in gene expression do you think the process could be regulated? Select all that apply: a) Before transcription begins. b) During the process of transcription. c) During the process of translation. d) After translation ends.arrow_forwardRNA polymerase binds to a _________ to initiate _________. a. mRNA; translation b. promoter; transcription c. primer; transcription d. transcription factor; translationarrow_forwardImagine that a mutation in a DNA molecule results in the codon CCU being changed to CCC. Both of these codons code for proline. The fact that more than one codon can code for the same amino acid is referred to as ___ a. the ambiguity of the genetic code b. the redundancy of the genetic code c. the randomness of the genetic code d. mutations in the genetic codearrow_forward
- A mutation takes place that switches a codon from ACG to ACA. What type of mutation is this? A) nonconservative missense B) silent C)nonsense D) Conservative missensearrow_forwardWhich of the following is an example of a transcription factor? A) gene B) a repressor C) a ribosome D) an intronarrow_forwardWhich is true about eukaryotic cDNA? Choose all that apply a. it is single stranded b. it is made up of only introns c. it is constructed from mRNA that is reverse transcribed d.arrow_forward
arrow_back_ios
SEE MORE QUESTIONS
arrow_forward_ios
Recommended textbooks for you
Concepts of BiologyBiologyISBN:9781938168116Author:Samantha Fowler, Rebecca Roush, James WisePublisher:OpenStax College
Concepts of Biology
Biology
ISBN:9781938168116
Author:Samantha Fowler, Rebecca Roush, James Wise
Publisher:OpenStax College
What is Genomics - Full Length; Author: Genome BC;https://www.youtube.com/watch?v=mmgIClg0Y1k;License: Standard youtube license