Q: The cells of sexual reproduction genes chromosomes gametes zygotes are called
A: Sexual reproduction is the process of creating new organisms by combining the genetic information of…
Q: population of 600 scorpions was split into four populations when irrigation canals were built…
A: When irrigation canals were created across their environment, the population of 600 scorpions was…
Q: Gram-negative bacteria are not killed by penicillin because they: do not have ribosomes.…
A: Bacteria can be gram-positive or gram-negative depending on how they are stained. Christian Gram…
Q: Fill in the blank The ______ acts to position RNA polymerase II for transcription initiation. The…
A: Introduction :- Histones are proteins that play a crucial role in packaging and organizing the DNA…
Q: Briefly compare and contrast hypertrophic cardiomyopathy to dilated cardiomyopathy with respect to…
A: Introduction :- Cardiomyopathy is a group of diseases that affect the heart muscle, making it…
Q: Iron atoms have been detected in the sun's atmosphere, some with many of their electrons stripped…
A: Atoms are made up of fundamental particles called electrons and protons. Protons have a positive…
Q: Careless Kris is using the microscope for the first time to look at cells and breaks a slide at high…
A: Introduction :- An objective lens is a type of lens that is located on the microscope near the…
Q: Explain how aging and lifestyle can affect the health and strength of bone.
A: Our skeleton system is made up of bones. There are 206 bones present in adult human. According to…
Q: Daughter cells produced at the end of meiosis II have Multiple Choice twice the number of…
A: The process by which the parent cells divide their genetic material into two or more daughter cells…
Q: Discuss the possibility of life on Mars. Will extremophiles prove useful? Can you explain the…
A: Astrobiology is interested in the possibility of life on Mars because of how close it is to Earth…
Q: 5. The electrochemical gradient can be utilised by ATP synthase to generate ATP - explain how the…
A: Photosynthesis - It is a process in which energy from sunlight is transformed into chemical energy…
Q: Each statement in the five numbers below describes a situation in which a person makes use of the…
A: In a scientific setting, a hypothesis is a testable claim about the relationship between two or more…
Q: Which term describes a substance that causes damage to the fetus during prenatal development? lanugo…
A: Prenatal development is the process by which a foetus grows and matures from conception to birth. It…
Q: Which form of cooking will result in meat having heme (Fe) groups being bound to nitric oxide?…
A: Food processing involves series of steps by employing various techniques to preserve food as well…
Q: Why would RNA have the characteristics necessary to function as a ribozyme? What's the deal with the…
A: RNA RNA is Ribonucleic acid. It is one of the nucleic acid that performs essential biological roles…
Q: do not know the answer for 3 and 4 about the punnet s
A: Introduction: Genetics is the branch of biology that studies heredity and the variation of inherited…
Q: Trade secret protection can be an effective strategy in an environment where patent protection is…
A: A patent can protect inventions, innovations. Trade secret protection confers owners the right to…
Q: There may be more than one correct answer for each Repetitive DNA include which of the following?…
A: Introduction :- Microsatellites are short, repetitive sequences of DNA, typically consisting of 1-6…
Q: Part 1 and Pa
A: Introduction: Genetic variation refers to differences in DNA sequence, gene expression, or phenotype…
Q: T F T F T T F F The major bonds in cellulose are a(1-4) bonds. Answer: During mRNA splicing, U2…
A: Introduction :- mRNA splicing is a post-transcriptional process in which introns (non-coding…
Q: or F Edge habitat always provides differential access to one habitat t
A: Introduction: The ecological response to habitat refers to the changes in species composition,…
Q: Explain what would occur during fetal development to an XY individual with a mutation causing a…
A: Introduction: Disorders of sex development (DSD) refer to a group of conditions that affect the…
Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…
A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…
Q: A dog breeder understood that her spaniels could be solid coloured, spotted or white owing to their…
A: Introduction :- A phenotype is the observable physical and behavioral characteristics of an…
Q: Which of the following is/are true with regard to the therapeutic index and the therapeutic window…
A: The therapeutic range is the range of doses for a drug in which it produces therapeutic effects with…
Q: The mode of inheritance of the auricular hypertrichous trait in the Brown family is clearly an…
A: Auricular hypertrichosis is a phenotypic condition in which excessive hair growth takes place in or…
Q: strains of Drosophila that have either normal legs or abnormally short legs and you are studying the…
A: Law of dominance says that dominant character is expressed in two conditions either in homozygous…
Q: Suppose that in goats, an independently sorting autosomal allele that produces a bearded phenotype…
A: Genes are the structural and functional units of heredity that carry nucleotide sequences that…
Q: This diagram shows two homologous chromosome pairs from a mouse after DNA replication. Chromosomes…
A: Cell cycle is series of events. It is responsible for dividing the parents and into daughter cells.…
Q: Required information View the animation below, then complete the quiz to test your knowledge of the…
A: Introduction Simple diffusion is a process that occurs without the use of energy or specialized…
Q: The trait for red hair is recessive (r) to the trait for brown hair (R). What is the probability…
A: Traits in simple terms are referred to as characteristics, these traits are controlled by hereditary…
Q: 1. Types of DNA damage and their causes.
A: DNA is the nucleic acid present in the cells of the living beings. It is composed of…
Q: A 16-square Punnett is time-consuming to draw out. Dr. Thompson can easily solve this problem by…
A: Genetics is the study of heredity and variation in living organisms. It involves the investigation…
Q: 12. You have discovered a new species of bacteria that lives in a deep ocean, hydrothermal vent,…
A: DNA - Deoxyribonucleic Acid (DNA) is the genetic material of all living organisms.
Q: TING not randomly 75% randomly 1:1 50% Mendel was able to derive the law of segregation by his study…
A: According to Mendel's law of segregation, Each gene separates from the others during gamete…
Q: A. Draw. Use the information shown below to construct a cladogram for some of the organisms.
A: Introduction :- A cladogram is a diagram used in evolutionary biology to represent the evolutionary…
Q: How
A: Introduction: A biosensor is a device that uses biological components, such as enzymes, antibodies,…
Q: Dr. Thompson learned in her university genetics course to memorize probability outcomes from…
A: The inheritance is encoded by two genes. These are M and N genes. M gene has two alleles. These are…
Q: Define the term 'distributive shock' and briefly explain why two of the three types of distributive…
A: The humans or other vertebrate's complete body is pumped by a group of organs called the blood…
Q: The main sweetener in Mackies Honeycomb is _______________
A: A sweetener adds sweetness in the product in which it is added. It may be of two types natural…
Q: 18. What is a codon? 19. List each codon from the mRNA molecule in # 18 (put a dash between each…
A: The sequences in DNA or RNA constitute nucleotides that are made up of bases (adenine, thymine…
Q: Draw a phylogeny of living things, incorporating the three domains and the five major subgroups of…
A: Phylogenetics is the study of relationships and the evolutionary history between or within groups of…
Q: Electrophoretic-Mobility Shift Assay DNA affinity chromatography Immunoprecipitation DNA footprint…
A: Introduction DNA replication is the process by which a cell makes a copy of its genetic material,…
Q: How is a male rather than a female zygote created? O The female produces a Y chromosome. The female…
A: A zygote is a cell stage that resulted due to the fertilization between two gametes i.e, male and…
Q: 1. Can you think of anything that would prevent meiosis from occurring in an organism with one set…
A: Introduction Chromosomes are long, coiled structures that are composed of DNA and proteins and are…
Q: What is coral bleaching? And 3 reason of bleaching. 2. Describe the five groups of organism found…
A: Introduction: Ecosystems are groups of creatures that have coevolved over a significant amount of…
Q: Explain why the phenotypic frequency of the tuskless trait is increasing in the African elephant…
A: The change in the character of an organism over generations is called evolution. The evolution of…
Q: he theory of endosymbiosis posits that mitochondria became organelles in eukaryotes engulfment event…
A: Endosymbiotic theory suggests that mitochondria was once an independent aerobic bacteria that got…
Q: What will happen if both SRP54 and SRalpha are bound to GTPgammaS instead of GTP? SRP54 and SRalpha…
A: SRP54 and SRalpha are proteins involved in the process of protein synthesis and folding in the…
Q: Assuming (i) that the two chromosomes in every homologous pair carry different alleles of some…
A: Introduction :- A chromosome is a structure in cells that contains genetic material in the form of…
Briefly describe the good harvesting practices to optimize the post-harvest quality of fresh fruits and vegetables.
Step by step
Solved in 2 steps
- Enlist the principles of crop production, discuss the importance of timely and accurate provision of plant protection measures in detail.explain the impact of responsible farming techniques and explore if the Sunflower Plant is responsibly harvestedHow post-harvest handling affects the quality of fruits and vegetables? Enlist the factors affecting post-harvest losses.
- describe the various stages that are involved in plant regenerative techniques associated with the production of 'clean' planting materials for farmers' use.Cite the general effects of the bio fertilizer on the yield of the crops applied with the bio fertilizer. What about the bio-pesticide on the pest and the crop?Describe how harvest techniques affect food preservation and quality.
- Write in detail about: Causes of low productivity of cereal and legume crops in Pakistan.Compare and contrast between lowland (rice) and upland crops (choose one among coconut, mango, banana, corn, soybean, or sweet potato) in terms of (1)land preparation (2) procedure, and (3) objectives.Based on usual practices, what do you think are the factors influencing the decision of farmers with regards to the schedule of harvesting?
