What is coral bleaching? And 3 reason of bleaching. 2. Describe the five groups of organism found in any aquatic ecosystem

Q: The main sweetener in Mackies Honeycomb is _______________

A: A sweetener adds sweetness in the product in which it is added. It may be of two types natural…

Q: Practice: DNA Structure and Replication 1. Label each part of the model to the right. Include…

A: DNA is a nucleic acid. It stores genetic information. DNA is the polymer of deoxyribonucleotides.…

Q: Calculate Simpson's Diversity Index D. Show your solutions. species Number (n) Gammarus pulex (water…

A: We are given number of individulas of different species. We have to calculate simpson's diversity…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Q: For the bacterial growth curve below in which phase does the number of cell divisions equal the…

A: Bacterial growth curve is the representation of different stages of bacterial growth and death. It…

Q: Unlike mammalian red blood cells, the red blood cells of amphibians contain large nuclei. Speculate…

A: INTRODUCTION Animals that can live both on land and in water are known as amphibians. They have a…

Q: The goal of this assignment is to introduce you to methods used to determine reliable sources of…

A: A nutritious diet supports normal growth, development, and ageing, helps people maintain a healthy…

Q: Describe the levels of organisation within the human body

A: The cell is the first level of organisation in the human body. Organs are formed from tissues, which…

Q: Telomere shorting is related to aging. Telomerase can extend telomeres. Why do we not just figure…

A: ANSWER: Despite the fact that telomerase has been related to the protection of cancer, studies have…

Q: 1. DNA is which macromolecule? 2. What is the monomer of this macromolecule? 3. What are the three…

A: DNA and RNA are the nucleic acids that can be found in cells. While RNA can be present in both the…

Q: Discuss fresh, living preparations vs fixed preparations. What are the advantages and disadvantages…

A: Introduction Microbiology is a branch of biology that deals with the study of microorganisms,…

Q: What are the receptors involved in long term alcohol use binding and between GABBA agonist receptor…

A: We need to describe the receptors involved in long-term alcohol use interaction, as well as the…

Q: control medium that demonstrates the general growth rate of mutant candidates

A: Control Medium: This medium is used to demonstrate the general growth rate of mutant candidates in…

Q: Average human height has changed over the past few centuries. The current generation's average…

A: INTRODUCTION Phenotypic variation refers to the physical characteristics or traits of an organism,…

Q: 400

A: Introduction: The greenhouse effect is a natural process that helps regulate the Earth's temperature…

Q: Briefly describe the short term regulation of blood pressure and relate the failure of these…

A: Short-term regulation of blood pressure is controlled by the autonomic nervous system. Blood…

Q: Oxygen-binding proteins myoglobin and hemoglobin require the prosthetic group ______.

A: Myoglobin and hemoglobin are protein molecules found in muscles and blood respectively.  Myoglobin…

Q: the role of GAL7 in galactose metabolism and its importance for cell function

A: 1) GAL7 is an enzyme involved in the metabolism of galactose, a type of sugar found in a variety of…

Q: The pedigree below shows the inheritance of the rare blistering disease (epidermolysis) in dogs.…

A: Introduction A gene exists in two alternative forms called allele. If both the alleles of a gene is…

Q: How would you educate a client (at risk of developing high cholesterol) about "good" and "bad"…

A: The body contains two different forms of cholesterol, known as good cholesterol and bad cholesterol.…

Q: 18. What is a codon? 19. List each codon from the mRNA molecule in # 18 (put a dash between each…

A: The sequences in DNA or RNA constitute nucleotides that are made up of bases (adenine, thymine…

Q: How is an experiment different from other scientific test such as observational studies or natural…

A: An experiment is a scientific test that uses controlled conditions to observe and measure the…

Q: Gram-negative bacteria are not killed by penicillin because they:    do not have ribosomes.…

A: Bacteria can be gram-positive or gram-negative depending on how they are stained. Christian Gram…

Q: Provide an mRNA sequence and the protein for the following DNA sequence 5'TCC GGT CAT'3

A: When a cell makes copy of RNA from the piece of  DNA, it is known as transcription. Transcription is…

Q: Speculate about the following details of mitosis. 1. Why do chromosomes need to condense during…

A: MITOSIS The cell duplication is known as mitosis, one cell divides into two genetically identical…

Q: What are 4 features (structural, functional, etc) that Watson and Crick discovered concerning B-DNA?

A: The discovery of the structure of B-DNA by James Watson and Francis Crick in 1953 was a major…

Q: CHOOSE THE ANSWER FROM THE FOLLOWING CHOICES: Cohesion High Polarity High Heat of Vaporization…

A: Water is a compound which consists of a two atoms of hydrogen and one atom of oxygen.Water have a…

Q: why riboflavin absorbs in the UV-Vis region

A: Riboflavin, also referred to as Vitamin B2, is a water-soluble vitamin that is crucial for the…

Q: II.)    Answer as comprehensively and as briefly as you can. When is a hypothesis accepted? Why is a…

A: Introduction  A hypothesis is a proposed explanation for a phenomenon. It is a tentative statement…

Q: Study the following questions: 1. Define the terms: transcription, promoter, enhancer, terminator.…

A: Transcription is the process of converting genetic information from a DNA molecule into an RNA…

Q: and decomposition According to the te at sequester carbor include carbon di

A: Introduction: The carbon cycle is a critical aspect of Earth's ecosystem, as it regulates the amount…

Q: Below is the pedigree of one form of hemophilia. Which type of hemophilia can you rule out? (You…

A: Hemophilia is a disease where blood doesn't clot normally . And due to this excessive bleeding…

Q: If drug X has an ED50 of 10 and LD50 of 50. Drug Y has an ED50 of 10 and LD50 of 100. Which of the…

A: Potency refers to the amount of a drug needed to produce a therapeutic effect. It is typically…

Q: 1. In the figure below, the panel on the left shows how the RBCs appeared in the blood when viewed…

A: Osmosis : Osmosis is the movement of water passing from a less concentrated solution to a more…

Q: Long Bones: Pick your favorite long bone What is it? Draw it. Draw its markings. Label the bone's…

A: Given that we have to pick a long bone. We have to draw it with its markings and label them.

Q: short notes on the history of Biosafety

A: The term "biosafety" is an umbrella term referring to different practices for ensuring the safety…

Q: MUSCLES (a) relaxed sacromere (b) contracted sacromere What is a sarcomere? Maria Wiek: weinely B…

A: INTRODUCTION Muscles are bundles of specialized cells in the body that contract to produce movement.…

Q: The enzyme amylase will affect the breakdown of carbohydrates, but it will not affect the break-…

A: The body system is the network of organs and tissues that interact and depend on one another to…

Q: What AI can do for medical imaging modalities and how it can improve them

A: Introduction - Artificial Intelligence is a human intelligence simulation by machine. The…

Q: Ligaments have what fiber type and why? Connective Tissue: Loose and Dense Tissue Fibers (Short…

A: Note:- Please always mention the needed parts in case of multiple questions. Thank you! Every…

Q: What features are present in a microscopic image that indicate the microscopic technique…

A: Introduction:- An area of digital image processing in which numerous image processing techniques are…

Q: Tetraethylammonia, a toxin that blocks potassium channels, will More than one answer may be…

A: Introduction : There are three phases of action potential. These are depolarisation, repolarisation…

Q: Describe the results depicted in Fg1.  and us it to provide an explanation for these observations…

A: Phenylketonuria (PKU) is an inherited disorder, meaning that it can be passed from parents to…

Q: Describe and compare at least two differences in the stem architecture of the ferns and the ancient…

A: INTRODUCTION A stem architecture is a type of software architecture that is built around a core of…

Q: Connective Tissue: Cell Types: (Short Answer Questions) Describe the three (3) types of cells and…

A: Since you've asked multiple questions, we're only answering the first three for you, if you want any…

Q: both parents are recessive short, name the 4 possible offspring.

A: Dominant allele is an allele which is able to express itself even in the presence of alternative…

Q: Calculate the amount of GFP in grams produced in the 25-L fermentation used to generate cells for…

A: The green fluorescent protein is an autofluorescent recombinant protein extracted from the jellyfish…

Q: Which of these statements describes an accurate model for how carbon dioxide and oxygen levels…

A: The ocean plays an important role in the global carbon cycle, exchanging carbon dioxide between the…

Q: Adaptation doesn’t perfect a species or an individual, instead it ....?

A: Adaptation is the adjustment of organisms to their environment to improve their chances at survival…

Q: More than one answer may be correct.  Myogenic cells in smooth muscle   Question 9 options:   are…

A: Introduction :- Gap junctions are specialized structures in the cell membrane that allow the direct…