Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply define the given. DO NOT JUST GOOGLE SEARCH THE ANSWER AND PASTE IT HERE
Q: What is the name given to study of biochemical nature of genes and how genes express their encoded…
A: Genes are the sequence of nucleotide bases present in the DNA in a cell. There are many genes in the…
Q: 1. In the realm of biology, what is parental investment theory? Do non-present 'parents' exhibit…
A: Parental investment means how much resources like time, energy or food etc. parent give to their…
Q: The septum completely separates the two halves of the mammalian heart. Because of this The blood…
A: The heart is a fist-sized organ that pumps the blood throughout the human body. It is the primary…
Q: Why has life expectancy changed significantly over the past century and life span has not?
A: Life span is the period from birth to the natural death of an organism. It refers to the maximum…
Q: 1. Name the structure at the red arrow. 2. What kind of epithelial tissue lines the structure at the…
A: Structure that Marked by red arrow is known as broad ligament. It connect side of uterus to the…
Q: Why is it not encouraged to recommend someone a strict plant-based diet (diet consisting of only…
A: Introduction Plant-based diet:- It is a diet consisting mostly or entirely of plant-based foods. .…
Q: A patient with poorly controlled Type I diabetes has blood drawn and finds that the pH of his blood…
A: A pateint with poorly controlled type-1 diabetes has blood drawn and find that pH of his blood is…
Q: How do we boost our immune system? write at least five practical ways.
A: Introduction Immune System:- It is a complex network of cells and proteins that defends the body…
Q: The human body is composed of water, proteins, fat, and minerals. Its specific heat reflects this…
A: Specific heat represents the amount of heat that is required to raise the temperature of one gram…
Q: It is the colored part of the front eye
A: Introduction The human eye is a sensory organ that responds to visible light and allows humans to…
Q: The 32 year-old woman is 20 weeks pregnant ar admitted for treatment of esophageal candidias to…
A: CM diagnosis represents the clinical modification system that is used by medical professionals to…
Q: hat does the hemoglobin graph regarding YO2 represent?
A: Hemoglobin, is an iron-containing oxygen-transport metalloprotein found in all vertebrates' red…
Q: T-lymphocytes are the most important arm of the immune response in protecting the community against…
A: T lymohocyte or T cell are two type : T helper cell T cytotoxic cell T helper activate cell…
Q: Vhy do obligate aerobes (and facultative anaerobes) need oxygen? Be specific
A: Obligate aerobes requires oxygen to grow because their energy production and respiration depends the…
Q: What helps to maintain a concentration gradient between blood and the air in the alveolus?
A: In alveoli the lungs and the blood exchange oxygen and carbon dioxide during the process of…
Q: Give an account of the excitation-contraction coupling (Figure 3) in skeletal Highlight the role of…
A: Each skeletal muscle fiber is a single cylindrical muscle cell. An individual skeletal muscle may be…
Q: Consider Cyclic Crossover on two Parent chromosomes: Parent1 = A0846172593B and Parent2 =…
A: The child chromosome will be... chromosome no 1 is... A94B5721608A chromosome no 2 is...…
Q: what casues leukopenia? detailed explanation
A: Introduction Leukopenia is a condition in which the total number of white blood cells is reduced.…
Q: Identify the following item correctly 1. It is a process wherein the six- carbon sugar, glucose is…
A: 1. The process wherein the six-carbon sugar, glucose is broken down into two molecules of pyruvate…
Q: crow shark dolphin lamprey frog y garter snake > > c> <<<< vertebrae - fins <U U < keratinous…
A: Cladogram is a diagram which shows the evolutionary relationships among organisms. i.e. a diagram…
Q: Explain how C3 plant leaf is different from C4 plant leaf and why?
A: Answer :- As we know that C3 plants are characterized as the plants that utilization the C3 pathway…
Q: An iron deficiency would affect the body's capacity to Select one: O a. transport oxygen O b.…
A: The transportation of oxygen from atmosphere to the individual cells occurs through a series of…
Q: 1. Do you continue eating food that is unhealthy? Why? 2. What can you suggest to your classmate and…
A: Different nutrients are required by the human body. Nutrient intake is accomplished through food.…
Q: 1. During the Neolithic Revolution, all humans switched from a hunter-gatherer lifestyle to an…
A: Answer is true
Q: Provide the correct sequence of steps in each process described below. Write the letters in series…
A: Translation involves “decoding” a messenger RNA (mRNA) and using its information to build a…
Q: Use the Dichotomous Key to ID a gram positive glucose fermenter that has the catalase enzyme.…
A: Dichotomous key It is a scientific tool identifies the different organisms on the basis of the…
Q: 1. Name the structure at the red arrow. 2. What kind of epithelial tissue lines the structure at the…
A: The process of formation of life form pre-existing life is known as the process of reproduction.…
Q: What are they made of (biomolecule type) and why are they so important to cells? How do they O…
A: All the metabolic reactions of our body depend on enzyme. There are various types of enzymes are…
Q: Accumulation of cytoskeletal proteins i.e. neurofilaments seen in Alzheimer disease
A: Alzheimer's disease is assumed to be caused by the abnormal build-up of proteins around the brain…
Q: 3. How does metamorphosis reduce competition between adults and immature forms? 4. How are the…
A: The phylum Arthropoda contains the biggest group of invertebrates (creatures lacking a spinal…
Q: 1. Inversion type that produces inv9 and inv12 2.Condition caused by translocation between…
A: Inversion is a type of chromosomal aberrations.
Q: waht are the indication that there are a presence of egg in patient that has paragonimiasis b.…
A: Pathogenic microrganism are microbes which are known to cause disease in other organisms or host .…
Q: What is a construct’s range of convenience?
A: Introduction:- Construct is a unique way one looks at his/her life. Range of convenience is…
Q: 3. Simplest population model & exponential growth: what do these mean, in words, and how are they…
A: This is related to the growth model of population. Let's discuss!
Q: The S-s antigen system in humans is controlled by two codominant alleles S and s. In a group of…
A: Chi square test is defined as the statistical test used to compare observed values with the expected…
Q: Which of the following is the consensus sequence of the Kozak sequence?. O 5'AGGAGGU 3' 0 5 ТАТААТ…
A: Please follow step 2 for detailed explanation.
Q: 1. During the Neolithic Revolution, all humans switched from a hunter-gatherer lifestyle to an…
A: Introduction The Stone Age was a prehistoric cultural phase or phase of human development,…
Q: 1. Name the structure at the red arrow. 2. What kind of epithelial tissue lines the structure at the…
A: The animal body is very complex, made up of several systems. Each system in the body has a distinct…
Q: 2-Female Drosophila heterozygous for three recessive mutations e (ebony body), st (scarlet eyes),…
A: Introduction Homozygous means that you inherit the same version of the gene from both parents,…
Q: Write an essay on the importance of bonding in digestion for organisms.
A: A digestive system consists of the GI tract that includes organs such as the mouth, pharynx,…
Q: A dental assistant is planning his/her continuing education courses for the new renewal cycle and is…
A: The primary analysis in dental care highlights the use of diagnostic and treatment techniques to…
Q: Write an account of Skeletal muscle contraction.
A: Introduction :- Skeletal muscles make up 30 to 40% of your total body weight. They're the muscles…
Q: (ii) Based on the information in Figure 1 and your knowledge, explain the olfactory transduction…
A: The system that plays the major role in olfactory transduction is located in the cilia of olfactory.…
Q: Cite the importance of fibrinogen in blood coagulation. Explain why dysfibrinogenemia can also…
A: Coagulation, also referred as clotting, is the transformation of blood from a fluid to a gelatin,…
Q: Coordination and timing of movements and balance are functions of which of the following brain…
A: Answer is D cerebellum
Q: Draw the common pest damage/sign of the pest given and the supply the information asked. You can…
A: Pest can destroy the crop plant . Most common pest are nematodes , termites , insects , bacteria ,…
Q: EUKARYOTIC RNA POLYMERASES Based on their elution order from ion-exchange chromatography…
A: Eukaryotic RNA polymerase : In eukaryotic cells we can find three different types of RNA…
Q: 1-If two loci are 30 cM apart, what proportion of the cells in prophase of the first meiotic…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: What can be done on a "Macro level" to solve the issue of COVID-19 Pandemic?
A: Answer: to solve the issue of COVID -19 pandemic that make available more beds in yhe hospital more…
Q: Select all of the traits provided below that appear in this specimen
A: The skull A skull is a bone representation of the head of the vertebrates. It forms the head…
Step by step
Solved in 3 steps
- Briefly explain the importance of the protein factor EF-Ts in the translation process. Do not simply define the given.Below is a picture of a ribosome. Name and give a function of all the “players” of translation found in the picture. Explain what happens during the following steps of translation: Initiation: Elongation: Termination:Why is it necessary for an in silico translation tool to provide 6 different frames of the translation product? Explain your answer.
- in not more than five sentences, compare and contrast prokaryotic from eukaryotic translation. expound on at least three differencesShown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code provided, list the amino acid sequence at the end of translation. Show how you got your answer.Methionine is used as the first amino acid for a particular polypeptide, but it is removed during the translation process in this case. After removal of the methionine, the final polypeptide is 246 amino acids in length. How many nucleotides were used to provide the genetic coding for this particular peptide chain? Explain your answer and be sure to account for the initiation and termination of the translation process.
- how would you explain the process of translation? Be detailed in your explanation.Which of the following is least likely following translation termination? The polypeptide is released. The mRNA is reused. The ribosome is reused. The polypeptide is immediately active.The images shown depict the initiation and elongation steps in protein translation. Arrange the images in the order in which these steps occur. A. B A C D B. B D A C C. C D A B D. A B C D
- Arrange the following components of translation in the approximate order in which they would appear or be used in prokaryotic protein synthesis, from first to last.30S initiation complex70S initation complexElongation Factor TuElongation Factor GInitiation Factor 3Release Factor 1fMet-TRNA fMetAn mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’Which of the following statements about the translation process is correct? a. RNA is made complimentary to DNA b. A protein is made from the DNA base sequence c. DNA is made complimentary to RNA d. A protein is made from the RNA base sequence