Below is a picture of a ribosome. Name and give a function of all the “players” of translation found in the picture. Explain what happens during the following steps of translation: Initiation:     Elongation:     Termination:

Q: During the termination of translation, what is the correct polypeptide sequence which will be…

A: DNA is the storehouse of genetic information. This information age expect by the formation of an…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: Protein is made up of a chain of monomeric subunits called amino acids joined together by peptide…

Q: Translation always begins by adding a methionine to the beginning of every

A:

Q: Explain the process translation. A complete answer will include the words below tRNA, amino acid,…

A: The translation is the process of amino acid change of protein synthesis from the mRNA sequence. The…

Q: What stops the translation process? when a stop codon on the mRNA enters the A site when a stop…

A: There are three types of stop codons which are present in m RNA and when they are encountered the…

Q: Which of the following are stages of translation? Select all that apply.

A: Translation is the cycle where ribosomes in the cytoplasm or endoplasmic reticulum integrate…

Q: Which molecules are required during Translation? Choose ALL that apply   Select all that apply:…

A: In biology & genetics, translation is defined as the interaction wherein ribosomes in the…

Q: Post-translational modification of proteins refers to the covalent and  enzymatic modification of…

A: The translation is a process by which the proteins are synthesized from the RNA. RNA polymerase and…

Q: Translate the following RNA sequence by using the genetic below. Start at the beginning of the…

A: The proteins are the final end product of a gene that ultimately determine the characteristics of an…

Q: Consider this list (below) of steps involved in translation. These steps are out of order.…

A: Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum generate…

Q: A frameshift mutation results in ___.   errors in DNA splicing   errors in DNA replication   a…

A: A frameshift mutation occurs with the insertion or deletion of one single base pair in the DNA. As…

Q: Indicate which of the following items are associated with transcription or translation.  This could…

A:

Q: . Which of the following descriptions of EF-Tu is correct? A. EF-Tu delivers fMet- RNA to the A site…

A: Introduction: Elongation factors deliver aminoacyl-tRNA to the ribosome.  Ef-Tu is a monomeric…

Q: You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its…

A: Option b

Q: Describe the steps (Initiation, Elongation and Termination) involved in translation of mRNA to…

A: All the living cells are made up of protein, which acts as building blocks for every organism. These…

Q: Which of the following types of mutation that changes the mRNA sequence after the codon that…

A: Frameshift mutation is a type of mutation that changes the reading frame via the indel mutation…

Q: Which of the following statements is TRUE? O DNA polymerase moves in a 5 to 3 direction in…

A: In this question, we have to identify the statement that is true.

Q: Which letter in the image represents the end product and the process of translation

A: Answer: CENTRAL DOGMA : It is the process of replication , transcription and translation of DNA.…

Q: Below is a template strand of DNA. Assume the transcription start site is outside of this sequence…

A: Transcription is the initial phase in gene expression, where data from a gene is utilized to develop…

Q: Initiation of translation begins when the ____. Ribosomal small subunit binds to the 5’ end of the…

A: Translation is the transformation of the mRNA into its respective protein chain encoded in it. This…

Q: Shown below is a DNA coding strand: 5' T-A-C-T-T-C-C-C-G-A-T-C-A-T-T 3' Using the genetic code…

A: The genes in DNA encode protein molecules, which serve as the cell's "workhorses," performing all…

Q: Describe in Your own words the Termination step of Translation process

A: Proteins are polypeptide molecules synthesized by the translation of mRNA in the ribosome.…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: Deoxyribonucleic acid is the genetic material found within a cell's nucleus. Before cell division,…

Q: Below is a diagram of charged tRNAs in the active site of the ribosome during translation of the…

A: Translation is the process of synthesis of protein. It takes place in the cytoplasm.

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…

Q: List the differences in the loading of the tRNA and its alignment with the mRNA between the…

A: Translation It is defined as the process of translating the sequence of mRNA molecules to the…

Q: Look carefully at the illustrations for gene translation. What mRNA codon specifies the tRNA…

A: As the illustration for the gene translation is not given. we are providing all the possible codons.

Q: Refer to the codon diagram on. Which of the following is a codon that will terminate translation?*

A: A termination codon or a stop codon is a group of three amino acids that is present in the mRNA that…

Q: Which of the following statements regarding the genetic code is false? The genetic code is…

A: Genetic code is used for ways in which the four bases of DNA- - the A, C, G, and Ts- - are hung…

Q: Assume the first nucleotide in the sequence is at the +1 position. Transcribe the DNA sequence into…

A: ANSWER;-

Q: Using the mRNA codon table below and your knowledge of transcription and translation, complete this…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Which of the following amino acids is carried by the tRNA that initiates translation in eukaryotes?…

A: Transfer RNA or tRNA is an adapter molecule, which plays an essential role in decoding the sequence…

Q: Which of the following are stages of translation?

A: The translation is the process of converting the information in mRNA to Proteins. Ribosome which has…

Q: Illustrate the process of translation by providing the correct bases for tRNA strand given the mRNA…

A:

Q: is the term used to describe the genetic code because a codon specify only for one amino acid is the…

A: 1. The genetic code is UNAMBIGUOUS i.e., each triplet ( codon) specifies only a single amino acid.…

Q: All of the following are directly involved in translation excepta) promoter.        b) ribosome.…

A: Introduction: The chemical nature of genes, such as genetic information encoding, gene expression,…

Q: An mRNA transcript is listed below and contains both start and termination codons. Assume that the…

A: mRNA(messenger RNA) is a type of RNA(ribonucleic acid) that carries complementary sequence…

Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…

A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand:  5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: Translation ends when the ribosome reaches           .   A. A termination sequence   B. A stop…

A: Translation is a process of formation of proteins from mRNA. This process is catalysed by ribosomes.…

Q: Explain the three steps (Codon recognition, peptide bond formation, translocation) in elongation…

A: The translation is the biological process that involves the conversion of the genetic information in…

Q: A section of an mRNA has the following nucleotide sequence: GCA GCU UGC CAG For the mRNA sequence…

A: In the question, we are given with mRNA sequence. mRNA is a sequence of ribonucleotides synthesized…

Q: In the initiation of translation, the process always lines up at the start codon. What is the start…

A: Translation refers to the process of polymerization of amino acids to form a polypeptide. The order…

Q: What is the order of the polypeptide chain shown in the images provided?    Starting at the…

A: Translation is the process of synthesizing proteins from RNA template through series of reactions on…

Q: Each one gives some basic information and summarizes its main role in translation.   rRNA:…

A: The synthesis of protein or polypeptide chain from the mRNA sequence (that contain genetic codon) is…

Q: Which of the following is an example of the degeneracy of the genetic code An amino acid can have…

A: There are total 64 combinations of base pairs that is needed to code 20 main amino acids  so more…

Q: What is the complementary DNA sequence to the following DNA sequence?   ATGCCATCG…

A: DNA is genetic material which is involved in transfer of information into the protein. It involves…

Q: Which of the following statements most accurately describes the action of the enzyme RNA…

A: Transcription is defined as the synthesis of mRNA from the template strand of DNA.

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation is the process of formation of protein from mRNA As in the question above start codon is…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The diagram illustrates the process of elongation of polypeptide chain by adding amino acids one by…

Genomics

Genes are responsible for transmitting the characters located on the chromosomes from one individual to another across the generations. Genetics is the study of different genes that are involved in different functions. Genetics is a branch of biology that studies genes, genetic diversity, and heredity in living organisms. The genetic system consists of genetic notations, which is a system of signs and symbols. Genotype refers to the organism's genetic composition, and phenotype refers to the observable property of the organism.