Methionine is used as the first amino acid for a particular polypeptide, but it is removed during the translation process in this case. After removal of the methionine, the final polypeptide is 246 amino acids in length. How many nucleotides were used to provide the genetic coding for this particular peptide chain? Explain your answer and be sure to account for the initiation and termination of the translation process.

Methionine is used as the first amino acid for a particular polypeptide, but it is removed during the translation process in this case. After removal of the methionine, the final polypeptide is 246 amino acids in length. How many nucleotides were used to provide the genetic coding for this particular peptide chain? Explain your answer and be sure to account for the initiation and termination of the translation process.

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)
For translation, identify two things that happen during each step - initiation, elongation and termination.
Which of the following best describes a sequence of events that happens during the elongation phase of translation? Group of answer choices A charged tRNA enters the P site of a ribosome; a tRNA bound to a peptide moves to the A site; an tRNA bound to a peptide exits the E site. None of these is an accurate description A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; an uncharged tRNA exits the E site. An uncharged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the P site; a charged tRNA exits the E site. A charged tRNA enters the A site of a ribosome; a tRNA bound to a peptide moves to the E site; an tRNA bound to a peptide exits the A site.
Many antibiotics are effective as drugs to fight off bacterial infections because they inhibit protein synthesis in bacterial cells. Using the information provided in the following table that highlights several antibiotics and their mode of action, discuss which phase of translation is inhibited: initiation, elongation, or termination. What other components of the translational machinery could be targeted to inhibit bacterial protein synthesis? Antibiotic Action 1. Streptomycin Binds to 30S ribosomal subunit 2. Chloramphenicol Inhibits peptidyl transferase of 70S ribosome 3. Tetracycline Inhibits binding of charged tRNA to the A site of the ribosome 4. Erythromycin Binds to free 50S particle and prevents formation of 70S ribosome 5. Kasugamycin Inhibits binding of tRNAfMet 6. Thiostrepton Prevents translocation by inhibiting EF-G
The process of translation involves three distinct phases: initiation, elongation, and termination. Which of the following is an accurate statement of a molecular event that occurs during one of the phases? A. All phases of translation require the energy of ATP to fuel molecular processes. B. The first components to assemble in initiation are the large ribosomal subunit, mRNA, and the initiator tRNA molecule. C. A peptide bond forms between the new amino acid and the amino acid at the C-terminus of the growing polypeptide chain. D. Amino acids are added to the polypeptide chain that sits in the A site of the translation initiation complex.
For each of the following initiation factors, how would eukaryotic initiation of translation be affected if it were missing? A. eIF 2 B. eIF4 C. eIF5
Why is it necessary for an in silico translation tool to provide 6 different frames of the translation product? Explain your answer.
For each of the following sequences, rank them in order (from best to worst) as sequences that could be used to initiate translation according to Kozak’s rules. GACGCCAUGG GCCUCCAUGC GCCAUCAAGG GCCACCAUGG
What is the order of the polypeptide chain shown in the images provided? Starting at the beginning of translation, determine the order of the amino acids in the polypeptide chain shown in this figure. Choose correct amino acids from the drop-down menu. (The choices from drop down menu are below). 1. (Choices): Leucine, Valine, Methionine 2. Leucine, Valine, Glycine 3. Valine, Methionine, Leucine 4. Methionine, Leucine, Glycine
An mRNA transcript is listed below and contains both start and termination codons. Assume that the initial methionine will stay on the polypeptide in this case. What amino acid sequence will be specified during translation? List the amino acids. The start codon is highlighted. 5’ – CAGCCAAGCAUGCUCGCAAAUGGACGUUGAUAUUUUGUC – 3’
You have isolated a new organism from a sulfur hot springs in Yellowstone and are investigating its genetic code. You isolate the translation machinery from this organism and use it to translate (in a test tube) some RNA sequences that you have generated. In these systems, ribosomes, amino acids, and buffers that support translation are added and there is no control of where translation begins. Assume 3 bases = a codon. One of the mRNAs that you add to the test tube has this sequence: 5’ACUACUACUACUACU… 3’ (The dots indicate that the previous sequence repeats.) If the new organism uses the same genetic code as other organisms on Earth, what polypeptide(s) would you expect as a result in this experiment? a)Leu-Leu-Leu… and Tyr-Tyr-Tyr… b)Thr-Thr-Thr… c) Leu-Leu-Leu… and Ser-Ser-Ser… and Tyr-Tyr-Tyr… d)Thr-Leu-Tyr-Leu… e)Thr-Thr-Thr… and Leu-Leu-Leu… and Tyr-Tyr-Tyr…
Researchers are studying the mechanism of the antibiotic chloramphenicol. They know that it prevents the formation of peptide bonds during translation. A model of the translation process is shown in the diagram. Which of the following describes where in the model chloramphenicol acts to interfere with the production of proteins from DNA? during initiation during elongation during termination during protein release