by namlng the amlno aclds from the N-terminal to the C- terminal. Use the long name, the 3-letter abbreviation and the 1-letter abbreviation. What is the pl of this peptide?

Q: What is the source of Kinins?

A: Kinins are small peptides. It is broken down by kininases. They act on phospholipase and increase…

Q: What are the primary structures of TATA-binding protein (for ex. letter amino acids),  What are the…

A: TATA-binding proteins (TBP) bind to Sequences on DNA called TATA boxes. TBP is a general…

Q: How is the peptide shown named (give each 3-letter name for the amino acids present)? Whichamino…

A: The peptide is made up of amino acid. The sequence of amino acid in this peptide is N - Val-Phe-Trp-…

Q: a. Identify the type of mutation shown below. b. How many amino acids are affected? c. What type of…

A: Mutation -  Mutation is defined as the sudden inheritable changes in the structure of the DNA or in…

Q: List five proteins that interact with the CFTR protein.

A: Proteins that interact with CFTR protein.

Q: What type of protein does FOG2 produce?

A: FOG 2 protein is coded by ZFPM 2. It is a family of transcription factors genes.

Q: What is protein denaturation? Give five agents that can denature proteins  Is it possible for a…

A: Proteins are one of the macromolecules that are present in living organisms. Proteins are made of…

Q: Why is the peptide formation always presented/read from N-terminal to C-terminal?

A: Introduction:  Amino acids are joined together by a condensation reaction between carboxylic and…

Q: first 20 amino acids of the CFTR protein?

A: CFTR is Cystic Fibrosis transmembrane Regulator Protein is an important protein that maintains the…

Q: Which peptide is the least likely to be made on the ribosome and why?

A: Ribosomes are composed of two subunits, the large and the small subunit, both of which consist of…

Q: What are the four components for the translocation of protein across endoplasmic reticulum? and…

A: Protein translocation is a process where proteins move between cellular components. It can occur…

Q: Label the N-terminal and the C-terminal in the above peptide.

A: The amino acid residue on one end of a peptide molecule does have an amine group on the alpha…

Q: NH, SH NH, он HN C. H,N HN PEPTIDE RNGCSN NH, PEPTIDE AHIKP

A: Trypsin is a serine protease that is found in the digestive system of vertebrates where it…

Q: What secondary structures are most prevalent in SHBG protein?

A: SHBG protein stands for sex hormone-binding globulin protein.

Q: using,   3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error…

A: The given sequence is 3'TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG5' The mRNA sequence will be…

Q: What are TBP (TATA Binding Protein) ?

A: TBP (TATA Binding Protein ) is a General transcription factor that binds specifically to a DNA…

Q: what amino acid is found at the resiue position 58 of 3GRS glucathione reducatse and why is this…

A: Glutathione reductase is in charge of maintaining the supply of reduced glutathione, which is one of…

Q: Describe lysine degradation.

A: The amino acid is an organic acid that contains an alpha carboxyl group, alpha amino group, a…

Q: Where will the amino (NH2) terminus of the protein be located (cytosol vs. ER lumen) if the “start”…

A: The endoplasmic reticulum is a cell organelle which is an extension of the nuclear envelope. Its…

Q: A solution of a peptide of unknown sequence was divided into two samples. One sample was treated…

A: Only twenty of the available amino acids are often present in proteins among all the possible amino…

Q: If a new isolated protein called STICKY and this STICKY protein contains a bHLH domain. Now, how we…

A: Protein motifs are the distinct conserved small polypeptide sequence in proteins. These super…

Q: What are the steps required to attach ubiquitin to a target protein?

A: Proteins contain amino acid chains. After the synthesis of proteins, they are folded with the help…

Q: The neighboring amino acid that TYR 368 interacts with is ILE 160. What are the properties of the…

A: Amino acids are natural mixes that contain amine and carboxyl functional groups, alongside a side…

Q: Define about catabolite-activating protein (CAP) ?

A: Certain terms are fundamental concepts and terms used in biology, which is the study of life and…

Q: Which amino acids would be expected to produce a similar sickling effect if substituted for Val at…

A: The blood disease Sickle-cell anemia occurs due to a substitution mutation. The mutated form of…

Q: How many different sequences of mRNA could encode a peptide with the sequence…

A: mRNA is decoded by the cells by reading their nucleotides in groups of three known as codons where…

Q: Why do both thymine and uracil specify the incorporation of adenine?

A:

Q: How many amino acids long is a zinc finger domain? What four conserved residues are contained in the…

A: Zinc finger are structural protein motif that has Zn ion in a coordinated bond to form a stable…

Q: TPA protein function. Use at least two sentences to describe the function of the TPA protein.

A: BASIC INFORMATION  BIOMOLECULES  These are the molecules that are made up of the biological elements…

Q: How many amino acids will the mRNA sequence "AUG GAC CUG UCG UGA" produce?

A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…

Q: What processes are involved in attaching ubiquitin to a target protein?

A: Amino acid chains are found in proteins. Proteins are folded with the aid of chaperones once they…

Q: Why might a protein precipitate when its tag is cleaved?

A: Precipitation of protein occurs because the change in pH or hydrophobicity results in the alteration…

Q: What is the peptide encoded by this mRNA sequence 5’-UCU-GCA- AAU-UAA -GUU-3’?

A: m-rna is synthesized in 5' to 3' direction and it used the enzyme rna polymerase and dna template…

Q: How can widely separated parts of a protein interact with the spike protein

A: Spike proteins are glycoproteins that are present on the surfaces of the enveloped viruses of many…

Q: why leucines are crucial part of GCN4 protein?

A: GCN4 is a protein that is usually known to be the controller of the gene expression in about one…

Q: If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed

A: If a mutation changes base triplet 1 from ATG to ATA, why will this not change the protein formed?…

Q: sars-coV-2 spike protien what is the isoelectric point of this peptide? VGIYLQKTSDHRPEFALAMN

A: ANSWER;- In order to the logical examination on the extreme intense respiratory disorder Covid 2…

Q: What aminos acid would the anticodon GAC be translated into?

A: * DNA will have four nucleotides  Adenine Guanine Cytosine Thymine * RNA will have four…

Q: what are the functions of 'sig' and 'S protein_mut'?

A: A gene is a genetic molecule that is passed down from one generation (parents) to the next…

Q: How can the binding of two amino acids for the peptide formation be described?

A: Introduction: Amino acids are the building blocks of peptides or proteins. They are a single…

Q: =Suggest, which part of these sequence referred to inner core of the otein/ outer core (use single…

A: Hydrophobic: A, C, I, L, M, F, W, V. Neutral: G, H, P, S, T, Y. Hydrophilic: R, N, D, Q, E, K

Q: VGIYLQKTSDHRPEFALAMN What is its isoelectric point of this peptide?

A: Isoelectric point is the pH at which the net charge is zero. pI is calculated as the average of two…

Q: Is there a difference in the effects of different salt solutions on protein denaturation? Why?

A: Yes, there is a difference in the effects of different salt solutions on protein denaturation.…

Q: Why would the amount of protein E bound to immobilized heparin fall in the presence of soluble…

A: Protein is a macronutrient that is fundamental for building bulk. It is normally found in creature…