Caffeine and nicotine have excitatory effects because they: reduce the threshold for excitation increase the threshold for excitation open potassium ion leakage channels open chemically-gated chloride ion channels close chemically-gated calcium ion channels
Q: The brown-nosed tweety bird can be found in both urban and wild environments. Researchers collected…
A: Introduction A phenotype is the observable characteristics of an organism, resulting from the…
Q: The fraternal birth order effect, in which the number of brothers a boy's mother carried before him…
A: Introduction Birth order refers to the position of a child in a family relative to their siblings.…
Q: Illustrate a SARS-CoV-2 genome organization showing all the genes. Label the 4 structural genes…
A: SARS-CoV 2 is a virus that caused pandemic COVID-19. Due to high mutation rates and highly…
Q: How are the light-capturing and Calvin cycle parts of photosynthesis coupled? How would poisoning…
A: Plants and some microbes employ the process of photosynthesis to transform light energy into…
Q: mRNA: amino acids: traits: DNA: | CGA CAA CAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG |…
A: The process of synthesis of mRNA with the help of DNA template is called transcription. This step is…
Q: The evidence supporting biological evolution includes A. all of the above B. patterns of…
A: The process by which the genetic makeup of populations of organisms changes over time, resulting in…
Q: Blue eyes and a straight hairline are both recessive alleles for two different genes. The dominant…
A: This is a dihybrid cross concerned with two characters at a time. Let the genotype for brown eyes be…
Q: 1. How can you detect an allele that is undergoing strong positive selection?
A: Note: “Since you have posted multiple questions, we will provide the solution only to the first…
Q: 5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can…
A: Genes are hereditary structures on genetic material. These control some specific particular traits.…
Q: The falling phase of the action potential is due to: O Nat influx through voltage-gated Nat…
A: During the rising phase of the action potential, there is a rapid influx of Na+ ions into the cell,…
Q: 1) Podocytes are A) part of the glomerulus B) able to filter blood plasma components by size…
A: According to Bartleby guidelines, we are supposed to answer first question in case of multiple…
Q: SDS-polyacrylamide gel electrophoresis and Polymerase chain reaction For quantitative result, the…
A: SDS polyacrylamide gel electrophoresis (SDS-PAGE) and polymerase chain reaction (PCR) are two…
Q: prevention and rehabilitation ofhamstring injuries on football players
A: Hamstring injuries: Hamstring injuries are common injuries that occur when one or more of the three…
Q: submit an unfilled necropsy report form commonly used in veterinary medicine for animals
A: Here is a sample of an unfilled necropsy report form commonly used in veterinary medicine for…
Q: In a table give three differences between antigen and antibodies Explain the structure of the…
A: Introduction: mmunity refers to the body's ability to defend against harmful foreign substances,…
Q: The characteristic(s) of discontinuous gel electrophoresis include A. All of the answers B. the…
A: Answer: All of the answer is correct Because here the low concentration of acrylamide don't…
Q: Urea... A. Is the least expensive nitrogen end-product to produce B. Is the least toxic nitrogen…
A: A: correct Urea is the chief nitrogenous end product to produce. B. Correct Ammonia is very…
Q: Peroxisomes will convert ethanol to acetaldehyde using_______NAD+ molecules.
A: Peroxisomes are membrane-bound organelles that are found in eukaryotic cells. They participate in a…
Q: Cross the following two genotypes: Aa Bb Cc Dd Ee x Aa bb Cc dd Ee. What is the proportion of AA Bb…
A: Mendelian genetics is also known as classical genetics that involves the study of the inheritance…
Q: The process of PCR essentially revolves around three phases. Briefly describe these phases and the…
A: The polymerase chain reaction (PCR) is a widely used technique in molecular biology that allows…
Q: Pigment in mouse fur is produced when the C allele is present. Individuals of the cc genoty white.…
A: This cross is the example of recessive epistasis. In recessive epistasis the phenotypic expression…
Q: Review what is known regarding the roots of obesity. Distinguish between the set point and the…
A: Obesity is a disorder in which excessive body fat has accumulated that increases the of health…
Q: Correlate transport maxima and gradient-time limited transport in proximal tubule.
A: In the kidney, the proximal tubule is the first segment of the renal tubule. It is in charge of…
Q: 3. In the following drawing, the top strand is the template DNA, and the bottom strand shows the…
A: In the above image, two strands are shown. The top strand being the template DNA and the bottom…
Q: Amikacin Antimicrobials Amoxicillin/clavulanate Ampicillin Cefazolin Cefepime Ceftriaxone…
A: Excessive Zn++ in the medium can have various effects on different groups of living organisms.…
Q: Calculate the amount of phycocyanin in Sample 1 in mg where A620=0.204 and A650=0.061, taking into…
A: Phycocyanin is a blue pigment found in cyanobacteria and certain algae. It is a phycobiliprotein…
Q: Imagine a researcher starting work on the obesity epidemic. In their previous work, they were an…
A: Given A researcher starting work on the obesity epidemic. In their previous work, they were an…
Q: Is bone marrow a type of tissue? Is cartilage a type of tissue?
A: Introduction A collection of like cells that collectively carry out a particular task for the body…
Q: How pathogen transmitted from person to person? 30 words in total please.
A: Pathogens are microorganisms (such as bacteria, viruses, fungi, and parasites) that can cause…
Q: Discuss how contraction and relaxation of arteriolar vascular smooth muscle regulates peripheral…
A: Arteriolar smooth muscles are involuntary muscles that are present in the arterioles. Their main…
Q: In rats, the spinal nucleus of the bulbocavernosus undergoes greater a) apoptosis; females b)…
A: Introduction:- Apoptosis is a form of programmed cell death that occurs naturally in multicellular…
Q: In studying Lokiarchaeota, researchers identified eukaryotic signature genes and used this…
A: Housekeeping genes are essential for basic cellular functions and are expressed at relatively…
Q: True or false sweat glands and apocrine glands are the same thing.
A: Any organ in the body that produces, stores, and releases some substances in the system can be…
Q: 4) Consider the production of flower color in the Japanese morning glory (Pharbitis nil). Dominant…
A: Considering the flower color production in the Japanese morning glory (Pharbitis nil). Genotype for…
Q: Describe one virus that is regarded as emerging and one that is re-emerging with regard to the…
A: A virus is a small infectious agent that can replicate only inside the living cells of organisms.…
Q: What would be the correct response of the myogenic mechanism to regulate glomerular filtration rate…
A: Maintaining a proper glomerular filtration rate (GFR) is necessary because it ensures the nephrons…
Q: Physical Growth Requirements. Describe the following results
A: Different microorganisms have different physical growth requirements. Specific conditions need to be…
Q: The process by which growth cones move toward a specific chemical is called a) contact guidance. b)…
A: Introduction Growth is the process of physical and/or biological development, generally resulting…
Q: Based on the alignment of these protein sequences below, which [pairs] of the genes appear to be…
A: Based on the alignment of the protein sequences provided in the image, it appears that: SEQUENCE 2…
Q: In a direct ELISA, which of the following does the patient provide? A.) Substrate B.) Enzymes C.)…
A: Introduction: Enzyme-linked immunosorbent test is referred to as ELISA. It is a method used in…
Q: What behaviors should Cass continue to maintain healthy blood sugar levels? Why?
A: Maintaining healthy blood sugar levels is critical for overall health, particularly for people who…
Q: If you wanted to use the molecular clock to estimate times of divergence for phylogenetically…
A: Introduction: A gene is a segment of DNA that contains the instructions for the development,…
Q: Case study 1 Melanoma A 50-year-old woman presented one year ago with a skin lesion, a biopsy was…
A: Cancer is a complicated illness caused by a variety of hereditary and environmental variables. The…
Q: Phagocytosis. Cells capable of phagocytosis. Stages of this phenomenon.
A: The science of the structure and function of cells is known as cell biology, and it is based on the…
Q: Write an equation for lipids with KOH and heat and then explain any differences between the three…
A: Saponification is a chemical reaction, which have a variety of uses in industries such as…
Q: Explain how monarch butterflies become toxic to predators. Does the predator die after eating a…
A: The monarch butterfly defends itself from vertebrates using two different techniques. The first…
Q: These figures show that: S Vor (1-min¹) 30 A 2.5 20 1.5 1.0 0.5 (50) 10 Concentric Eccentric…
A: There are 2 types of isotonic muscle contractions: concentric and eccentric. Eccentric contraction…
Q: 25. The combination of alternating dark A bands and light _______________ bands gives a muscle fiber…
A: Introduction Muscle contraction is the process by which muscle fibers generate tension or force in…
Q: Create a concept map that illustrates transcription in eukaryotes by including the following terms:…
A: There are three types of RNA polymerases in eukaryotes: RNA polymerase I, II, and III, which are…
Q: Do you think some ingrediants in foods, that prolong the life of that food, make it easier or harder…
A: Preservatives: Preservatives are substances added to food and other products to prevent spoilage,…
Caffeine and nicotine have excitatory effects because they:
- reduce the threshold for excitation
- increase the threshold for excitation
- open potassium ion leakage channels
- open chemically-gated chloride ion channels
- close chemically-gated calcium ion channels
( explain deeply with step by step type the answer).
Trending now
This is a popular solution!
Step by step
Solved in 3 steps
- Draw and label an action potential, indicating the ion movements responsible for the rising phase and the falling phase.Explain how ligand-gated channels are opened, using nicotinic ACh receptors as an example.Which statement about nicotinic acetylcholine receptors (nAChRs) is true? a. Each nAChR is composed of seven different protein subunits. b. They are ionotropic receptors and conduct Na+ and Ca2+ ions across the cell membrane causing depolarization and a fast excitatory response. c. They are ionotropic receptors and conduct K+ ions across the cell membrane, causing depolarization and a fast excitatory response. d. They are found in all areas of the nervous system except the brain.
- What are the neurotransmitters that bind to ionotropic channels and allow for cation influx? Select all that apply. Group of answer choices A. glutamate B. GABA C. dopamine D. acetylcholineLucy smokes a cigarette which has nicotine in it. Nicotine activates ________ receptors and has an _______ effect on receptor proteins. A. Nicotinic ACh, excitatory B. Muscarinic ACh, excitatory C. Nicotinic ACh, inhibitory D. Muscarinic ACh, inhibitory E. None of the aboveOne mechanism underlying the anesthesia is opening increase numbers of potassium leak channels. How/why would this mechanism cause anesthesia?
- Nicotinic receptors bind A. acetylcholine and allow chloride ions to exit the cell. B. acetylcholine and allow sodium ions to enter the cell. C. muscarine and increase the contractility of intestinal muscle. D. norepinephrine and can either stimulate or inhibit the cell. E. norepinephrine and allow potassium entry, thereby exciting the cell.If a person is given an experimental drug, which response would indicate that this drug is an norepinephrine/epinephrine agonist? decreased blood pressure pupil constriction constriction of respiratory airways high blood sugar (hyperglycemia) decreased heart ratePhenytoin (sodium channel blocker) and ethosuximide (calcium channel blocker) are anti-seizure drugs that stop seizures from happening. These drugs work by inhibiting electrical impulses (action potentials) from occurring. Explain the reasons why action potentials do not occur when these channels are inhibited.
- When ethanol binds to glutamate receptors it operates as a receptor ______________________ and prevents cellular _________________________. A. agonist / depolarization B. antagonist / hyperpolarization C. antagonist / depolarization D. agonist / hyperpolarizationGive an account of signalling at a neuromuscular junction through the nicotinic acetylcholine receptor.The neurotransmitter acetylcholine is released from presynaptic neurons in response to a nerve impulse and diffuses across the È synaptic cleft, or neuromuscular junction, to a receptor on another neuron or a muscle cell. The nicotinic acetylcholine receptor is a pentamer containing four types of subunits, azßys. Place the events in the correct order, from the release of acetylcholine from a neuron to receptor resensitization: -excited presynaptic neuron releases acetylcholine -acetylcholine diffuses across synaptic cleft or neuromuscular junction -acetylcholine is released from the binding sites -two acetylcholine bind to a receptor; the gate opens -small cations pass through the open pore of the receptor -the plasma membrane of the target cell is depolarized -two acetylcholine are tightly bound to a receptor; the gate is closed -one acetylcholine binds to a receptor; the gate is closed.