Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars
Q: The vast majority of structures deposited in the Protein Databank (>95%) have been determined using…
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: A newly developed qPCR has an efficiency of 75%, and each cycle is pretty consistent. In this qPCR,…
A: The qPCR is generally useful to determine the actual value of PCR product present at provided…
Q: True or False? It takes Carbon dioxide and water in the presence of sunlight to produce…
A: Carbohydrates are formed in green plants by the process of photosynthesis.
Q: Question 4 Match the following descriptions to the given choices v Synthesized from a steroid…
A: A vitamin is an organic molecule which is an essential micronutrient for organism and are needed…
Q: . What mRNA base sequence would be obtained from the following portion of a gene?
A: Genetic information is transferred from genes to the proteins via messenger RNA.…
Q: How to calculate the amount of myoglobin in grams from a 2.0 ml sample of protein extract???
A: Beer Lamberts law states that value of Absorption at a particular wavelength of light by an analyte…
Q: The picture below shows the body's response to acute stress, which is to release adrenaline…
A: Introduction: Adrenergic neurons release norepinephrine as the primary neurotransmitter. These…
Q: Which mayonnaise is thicker? Mixing oil to the mixture gradually or mixing all the ingredients in?…
A: Mayonnaise is a condiment used in burgers, salads, and sandwiches. Mayonnaise is considered as a…
Q: INCREASE in BP DECREASE in BP Increased preload Activation of the adrenergic system Venoconstriction…
A: The blood pressure alteration is influenced by many factors. The changes in blood pressure are…
Q: Second messenger in regulation of metabolism is: Select one: O a. hormones Оb. АТР neurotransmitters…
A: Secondary Messengers are the molecules that act as amplifying components in the cell signalling and…
Q: 2. An MRNA has a sequence AAAUUACUCGAAAUUGCGUGUAGUS'. DNA, t-RNA and amino acid sequence of the…
A: Given mRNA from 5' to 3' direction: UGAUGUGCGUUAAAGCUCAUUAAA
Q: What is the molecular weight of a linear polysaccharide consisting of 7 galactose monomers and 1…
A: Glucose and galactose are monosaccharides that are also referred to as simple sugars. They represent…
Q: Genetically modifying seeds to produce herbicide-resistant plants that increase crop yields has…
A: A Genetically modified technology is formed of insertion of a DNA into the genome of an organism.…
Q: Describe three important health disorders or diseases related to abnormal cholesterol metabolism
A: Cholesterol is a class of certain organic molecules which is found in the body of living organisms.…
Q: When human hemoglobin undergoes a mutation, the mutant protein usually does not replace all of the…
A: The cytosol of red blood cells contains the oxygen-carrying globular protein hemoglobin, which is…
Q: HO CH, H. CH2 OH I-
A: An amino group and an acid group-containing organic molecules are called Amino acids. when…
Q: 1. Stages of the insulin biosynthesis and maturation. Components: A. N-terminal amino acid. B.…
A: Introduction: Insulin is a hormone that is synthesized in the beta cells of the pancreatic islets…
Q: - RNA can take part in eukaryotic intron splicing but DNA cannot. Describe in technical detail why…
A: Splicing is a process of removal of non-coding (introns) regions from the gene. Incase of…
Q: Diagram to compare & contrast CATABOLISM vs ANABOLISM such as its process/mechanism, relation with…
A: Anabolism and Catabolism are the two broad type of biochemical reaction in metabolism where…
Q: Tyrosine came from the Greek word "tyros" which means cheese as it was discovered in cheese by…
A: the isoelectric point of an amino acid is the pH at which the net electric charge of that amino acid…
Q: What 3 antibiotics that are active against G= and G- organisms contain both proteinogenic and…
A: Hi, thanks a lot for submitting the question. Here question have typo error and G= is G+ I believe…
Q: Review method used to increase the solubility of a drug under the following headings co solvents PH…
A: Bioavailability is a powerful determinant of drug absorption. It represents the administered dose…
Q: 5. Amino acid methionine is used as medicine due to its lipotropic ellect («removes» fat excess from…
A: The orange structure is the liver The red arrows indicate the transport is happening via the blood…
Q: 4. You prepare a solution of a biopharmaceutical drug candidate. Initially you have a clear…
A: Biopharmaceutical drugs are the drugs prepared from biological sources such as microorganisms, human…
Q: The "D" in DNA stands for which of the following?
A: DNA : Chemical name for molecule which carries genetic instructions in the living organisms.
Q: जन्का ली देकर परार देेल लब्पsogene sn जाक ? A) Hn iso2gme cam be Coeed 0Siलह कसक्ट कर Te १riance…
A: Enzymes are the protein molecules that increase the rate of reactions by decreasing the activation…
Q: Progesterone is mainly responsible for the development of sexual characteristics and function O True…
A: Progesterone is a C-21 steroid hormone. Cholesterol is the precursor for progesterone. Progesterone…
Q: During the treatment of hyperlipidemia, what is the metabolism of lipoproteins; and the mechanism of…
A: Hyperlipidemia refers to a high-level blood lipids like cholesterol (non-HDL cholesterol and LDL…
Q: c. (i) Which enzyme in prokaryotes synthesizes the primers? On which strand (leading or lagging…
A: DNA replication, or copying of a cell's DNA, is semiconservative, which means that each strand of…
Q: Н Но H OH HO, OH H HN- a. Glucocerebroside CH3 OH H3C -N-CH,- CH2-0-P-01 HN CH3 b. Sphingomyelin
A: Glucocerebrosides are lipid derivatives composed of sphingosine, fatty acid and a glucose residue.…
Q: Write an equation to describe the catabolism of an aerobic hydrogen oxidizer
A: “Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: i need the answer quickly
A: Vitamin B6 aids in the maintenance of a healthy level of this amino acid in the blood. A more…
Q: Match the following lipids with their functions
A: Lipids are the various organic compounds which are insoluble in water. These are- fats, waxes,…
Q: Draw a linear disaccharide of glucose. is an alternating alpha (1-4) and b (1-4) linkages energy…
A: Introduction:- The question is all about the structure of glucose that are isomers of each other as…
Q: An individual developed a condition characterized by progressive muscular weakness and aching muscle…
A: This shuttle functions in the transporting the fatty acids present in the cytosol to the…
Q: Calculate the fractional charge on ASP at pH 3 using the following pKa values (1. 9.90, 3.90). Write…
A: A total of 300 amino acids are present in the biological system out of the 20 are part of…
Q: Match the following lipid vitamins with their deficiencies
A: A vitamin is a one of the most important organic molecule which is present in every living…
Q: Compare and contrast DNA replication and PCR.
A: Dna replication is the process of Synthesis of new daughter dna molecules or duplication of parent…
Q: With Fehling's reagent (under certain conditions) interact: A. Glucose B. Quinine hydrochloride C.…
A: Fehling's reagent is a reagent commonly employed in differentiation of water soluble carbohydrates…
Q: Describe how you would make 10mls of a solution with concentration: 10mM Glucose (MW-180.16g/mole)…
A: In a solution concentration of solute is reduced simply by mixing more water or by adding more…
Q: Explain the process of Drug Elimination
A: Drug elimination is the removal of drug from the body.
Q: 1. A farmer crossed a round-shaped (T) and yellow-colored (Y) seed plant carrying yellow seeds (Y)…
A: Dominant allele of a gene expresses phenotype even if it present in single copy. So dominant…
Q: 1. What are processed foods?
A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…
Q: In cholesterol, to which ring of the steroid system is the hydroxyl group attached? B O A
A: cholesterol is a sterol and is the primary compound from which synthesis of many steroid hormones,…
Q: 2. Compound 1 below is metabolized to compound 2 by CYP. The enzyme is gradually inactivated during…
A: Cytochrome P450 are a class of proteins with the ability to catalyze oxidation reactions. They…
Q: 8. For each of the following DNA template strands a. 3' TACGGC 5' b. 3' CCATTA 5' Determine: a. the…
A: The heterogenous nuclear ribonucleoprotein (hnRNP) is the initial step of synthesizing mRNA during…
Q: List and describe the major tissues involved in cholesterol metabolism and their core enzymes.
A: In addition to serving in the manufacture of steroid hormones, vitamin D, and bile acids,…
Q: What might be the dangers in using supplements to get DHA in your diet?
A: Docosahexaenoic acid (DHA) is an omega-3 fatty acid found in cold-water fish like tuna and salmon,…
Q: 1. Is the Homo sapiens phenylalanine hydroxylase (PAH) gene encoding a non-coding protein or an…
A: Phenyl alanine hydroxylase is an enzyme that causes phenylketonuria on its deficiency. Phenyl…
Q: Which of the following is a product of the first stage of the pentose phosphate pathway? Group of…
A: NADPH : Phosphorylated version of the coenzyme NADH Pentose Phosphate Pathway : PPP 1st stage of PPP…
14.
Can you please briefly describe the reaction mechanism that permits the detection of reducing sugars
Step by step
Solved in 2 steps with 1 images
- 1. Explain why sucrose is non reducing sugar?5. a) Why would an enzyme that is effective with one reaction have no effect on another reaction?Which of the following methods is not used by enzymes to increase the rate of reactions? a. covalent bonding with the substrate at their active site b. bringing reacting molecules into close prosimity c. orienting reactants into positions to favor transition states d. changing charges on reactants to hasten their reactivity e. increasing fit of enzyme and substrate that reduces the energy of activation
- The enzyme directly responsible for almost all carbon fixation on Earth is (a) rubisco (b) PEP carboxylase (c) ATP synthase (d) phosphofructokinase (e) maltaseIn an enzymatic reaction: a. the enzyme leaves the reaction chemically unchanged. b. if the enzyme molecules approach maximal rate, and the substrate is continually increased, the rate of the reaction does not reach saturation. c. in the stomach, enzymes would have an optimal activity at a neutral pH. d. increasing temperature above the optimal value slows the reaction rate. e. the least important level of organization for an enzyme is its tertiary structure.6. When a concentrated alkali solution acts on the purine cycle, it breaks down? A. Ester group B. Imidazole nucleus C. Dioxopyrimidine nucleus D. Lactone cycle.
- 1. The main sweetener in Mackies Honeycomb is _______________1. What is the reason why sucrose is a non reducing sugar? 2. In glycosidic linkage formation between monosaccharide units, discuss how products were formed.8. Match each of the following amino acids with the intermediate needed for its synthesis.(a) 3-Phosphoglycerate 1. glutamate 2. serine 3. asparagine (b) oxaloacetate 1. glutamate 2. serine 3. Asparagine
- 18. Explain why the Krebs cycle can be referred to as the final common pathway of thedegradation of organic compounds.5. Which of the following statements is/are correct regarding allosteric regulation?a) Allosteric effector controls the activity of an enzyme by irreversible binding.b) Allosteric effector binds to the regulatory sitec) Allosteric activator causes changes in the catalytic site enhancing the substrate binding.d) Allosteric inhibitor causes changes in the catalytic site decreasing the substrate binding. explain each option4 draw the reaction mechanism for the formation of the covalent intermediate in the serine protease chymotrypsin, showing how the active-site amino acid residues participate in the reaction
