Chargaff's results yielded a molar ratio of 1.22 for A to G in wheat DNA, 1.18 for T to C, 1.00 for A to T, and 0.970 for G to C. The ratio of purines to pyrimidines is 0.990. Calculate the mole fractions of A, G, T and C in wheat DNA. Mole fraction of A= Mole fraction of G = Mole fraction of T= Mole fraction of C= Submit Answer [References Try Another Version 3 item attempts remaining

Chargaff's results yielded a molar ratio of 1.22 for A to G in wheat DNA, 1.18 for T to C, 1.00 for A to T, and 0.970 for G to C. The ratio of purines to pyrimidines is 0.990. Calculate the mole fractions of A, G, T and C in wheat DNA. Mole fraction of A= Mole fraction of G = Mole fraction of T= Mole fraction of C= Submit Answer [References Try Another Version 3 item attempts remaining

Introduction to General, Organic and Biochemistry

11th Edition

ISBN:9781285869759

Author:Frederick A. Bettelheim, William H. Brown, Mary K. Campbell, Shawn O. Farrell, Omar Torres

Publisher:Frederick A. Bettelheim, William H. Brown, Mary K. Campbell, Shawn O. Farrell, Omar Torres

Chapter25: Nucleotides, Nucleic Acids, And Heredity

Section: Chapter Questions

Problem 25.24P

See similar textbooks

Similar questions

Briefly explain how anodic stripping analysis is able to be used for quantifying DNA
Calculate the amount of phycocyanin in Sample 1 in mg where A620=0.211 and A650=0.086, taking into account the dilution factor as per question 6 (100ul), and the total volume of extract as per question 4 (140ml) . Note your answer to 2 decimal places
What is a matching sequence of bases for ‘UTAG’ using Watson-Crick base pairing? Why is thissequence not normally one that you would find in DNA or RNA? Give a rational explanation forhow it might arise in DNA.
Two phenylalanine residues are separated by 1.0 nm in a polypeptide. Calculate the dispersion interaction (kJ×mol-1). (a = 1.0 ´ 10-29 m3) I = 500 kJ×mol-1 ( ) -0.204 ( ) -0.133 ( ) -0.0688 ( ) -0.0375 ( ) -0.0233
what is the principle of GC-MS?
Q5. Give one condition for the denaturation step employed in blotting Q6. Give the main two compounds responsible for the formation of the gels Q7. The addition of which two reagents are also necessary to initiate the polymerization (gel formation)
Which is correct for polarography? I-polarography is an amperometry method conducted with a dripping Hg electrode. II-The diffusion current in the plateau region of the polarographic wave is proportional to the concentration of the analyte and is used for quantitative analysis. III-The half-wave potential is characteristic of the analyte in a given environment and can be used for qualitative analysis. IV-fresh Hg drops provide reproducible results. V-polarography is primarily used to study oxidations, Hg can be reduced when studying reductions
How can false low results due to the Hook Effect be accounted for in immunoassay testing?
Why is strict implementation of LQMS (Laboratory Quality Management System) or GLP is necessary ? What are the elements ?
Pick all that are TRUE regarding analysis of quaternary structures of proteins using polyacrylamide electrophoresis:I. The added β-mercaptoethanol disrupts S--S bonds bridging the polypeptide chains causing the appearance of higher Rf bands compared to the native protein run. II. Heating up any protein before subjecting to SDS-PAGE will always result in the formation of more than one band.III. A good asymmetrical gel layout would be : (Lane 1) MW ladder, (2) native protein, (3) protein + β-ME, (4) protein + HCL, (5) protein + β-ME + HCl.IV. Formation of a single band in the protein + β-ME + HCl run, whose Rf is lower than the native run, could be indicative that the protein is a homodimer.A. I onlyB. I and IIC. II and IIVD. None is true.pls explain
Is both 2880 and 2970 sp3 C-H stretches?
Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give clear handwritten answer in 2 figures)