Choices are in the picture.Choose the primary impact of the given agents to the genetic material.1. Metronidazole2. Doxorubicin3. Mercaptopurine4. Nitrofurantoin5. Ciprofloxacin deletion of genetic informationprevents synthesis of deoxyribonucleotide componentssingle-strand DNA breakagedouble-strand DNA breakagebreakage of H-bonds by inserting chemicals in betweencleaves the prokaryotic DNAarrrests DNA replication by inhibiting prokaryotic DNA gyrasearrrests DNA replication by inhibiting eukaryotic DNA gyrase

Gene inhibition is a therapeutic approach that leads to the silencing of the expression of a mutated…

Answered: Choose the primary impact of the given…

Choose the primary impact of the given agents to the genetic material. 1. Metronidazole 2. Doxorubicin 3. Mercaptopurine 4. Nitrofurantoin 5. Ciprofloxacin

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Related questions

Q: Explain the methodology, rationale, and challenges in the control of Triatomine vectors.

A: Triatomine: Triatominae bugs are the vectors of Chagas disease. These belong to the Reduviidae…

Q: Which of the following statement is an advantage of gene cloning in medicinal applications? I.…

A: Cloning is the creation of a replica that is perfectly similar. Copying short stretches of DNA…

Q: What are the things to consider in making a good primer? Does temperature affects the primer design?…

A: A primer is just a tiny sequence of nucleic acids that serve as the origin for DNA synthesis.

Q: Antisera used in blood typing contain: A. both agglutinins and agglutinogens B. agglutinins…

A: Blood typing is a test performed to determine the blood group. It is also known as ABO typing. In…

Q: Explain the effect of COM-blockers on bacterial transformation and their application in controlling…

A: Pathogens are disease-causing organisms that can cause humans to become ill or die depending on the…

Q: s CHORIOALLANTOIC MEMBRANE (CAM) Assay enough for the assessment on the carcinogenicity of a certain…

A: Introduction- The CAM assay is a kind of technique that is very vigorous used to watch the invasion…

Q: Briefly discuss the reason why CoQ10 has been formulated into skin care products and used as food…

A: CoQ10 Coenzyme Q10 naturally occurs in the human body and it found in almost all cells of the human…

Q: What are the reasons why the products based on onion and garlic that use against COVID-19 can be…

A: Generally, intake of onions could help build immunity to protect against infections. Onions are…

Q: Is liquid chromatography one of the current analytical methods in detecting porcine gelatin?Explain…

A: Yes, High Performance Liquid Chromatography is one of the current analytical methods in detection of…

Q: 46. In the Philippines, which of the following serves as the lead advisory body to the President on…

A: Introduction A viral disease is any illness or health condition caused by a virus, It occurs when a…

Q: intercalating agent

A: Intercalation is the process in which there is the insertion of molecules between the planar bases…

Q: What are the COVID-19 safety guidelines for health care professionals? what are the Saudi Patient…

A: COVID-19:- COVID-19 is a coronavirus-related, potentially severe respiratory infection…

Q: Can the delta variant be deadly to kids

A: The most common symptoms for the Delta variant are fever, headache, sore throat, and runny nose. It…

Q: Answer the questions briefly and concisely. Describe the limitations of FANA Describe the other…

A: FANA stands for fluorescent antinuclear antibody which detects a specific kind of antibody in the…

Q: What are the things to consider in making a good primer? 2. Does temperature affects the primer…

A: Especially in PCR Primer Design, designing oligonucleotides and ensuring that you have the proper…

Q: Lamivudine (3TC) An analogue of deoxycytosine, a DNA component Needs to be first phosphorylated by…

A: HIV: Human immunodeficiency viruses (HIV) are two Lentivirus (a retrovirus subgroup) species that…

Q: In automated sequencing, you are given a printout of the sense strand of your DNA. The printout is…

A: Introduction Nucleic Acids:- Nucleic acids are biopolymers, macromolecules, essential to all known…

Q: an exception in this chapter with HIV disease. HIV must be confirmed by the physician’s diagnostic…

A: Introduction:- HIV infections and medical knowledge about the spectrum of illnesses Cause by this…

Q: Describe tamper resistant(pilfer proof and child resistance packaging) pharmaceutical products…

A: Tamper resistant has been defined in the USA as the degree to which tampering is apparent to the…

Q: 1.How Jennifer Anne Doudna's works (CRISPR Cas 9) impacted research and industry. 2.Write about…

A: Introduction Jennifer Anne Doudna discovered a molecular tool known as clustered regularly…

Q: One laboratory method to detect for COVID-19 infection is via real time RT-PCR. The process starts…

A: Real-time RT–PCR is a nuclear-derived test for detecting the presence of RNA or DNA of the pathogen…

Q: Define the following terms: • Preclinical Trial • Clinical Trials • FDA Review • Lead discovery •…

A: All the given terms are associated with drug development process.

Q: Garlic as platform to overcome drug resistance of bacteria. May I ask for help about the statement…

A: Garlic (Allium sativum) has potent antimicrobial activity due to allicin (diallylthiosulfinate)…

Q: a) What is the PPV of the assay? b) What is the NPV of the assay? c) Comment on your findings

A: There are two parameters that help us determine the performance of a certain diagnostic test or…

Q: How do nucleotide analogs function as therapeutic agents? Explain the mechanism with specific…

A: FUNCTION 1. Nucleotide analogs are nucleotides and which contains a nucleic acid analogs,sugar and a…

Q: Write the Drug Discovery Process of Diltiazem?

A: *The revelation of Ca++ antagonism as a modern principle of activity of coronary drugs comes back to…

Q: Explain the drug discovery process of Losartan?

A: Drug discovery process of Losartan Saralasin is an octa-peptide counterpart of Ang II that replaces…

Q: Hi, can you kindly make 3 concepts that is related to the research topic which is "Compromising own…

A: Concept research topic 1 Risk of acquiring COVID-19 in the phase of treating other infected clients.…

Q: What is the mechanism of action of the drug LIDOCAINE? pls. dont plagiarize

A: Lidocaine- Lidocaine is a member of the local anesthetics family of drugs. This medication works…

Q: What is selective toxicity in the context of antibiotic chemotherapy? Support your answer with…

A: Introduction :- Antimicrobial chemotherapy is used to treat infectious diseases by fighting the…

Q: Discuss some of the strategies which have been developed for using nucleic acids as therapeutic…

A: Elucidation of metabolic pathways that are related to a disease combined with the unravelling of the…

Q: 1. Answer the following questions A. What is the antimicrobial mode of action in the antimicrobial…

A: Answer A

Q: Stems cells can be used in the following medical technologies. A. gene therapy B. stem cell…

A: Stem cells are specialized cells present in various parts of the human body that are able to…

Q: ght we, as epidemiologists, increase the validity of genetic studies? What recommendations do you…

A: Epidemiology is considered a branch of medical science that deals with the identification and…

Q: What are Targeted drug delivery systems ? Please explain the ideal properties of Targeted drug…

A: A drug is a molecule which might resemble a organic molecule inside the body or an exogenous…

Q: 2a.) Illustrate below the image you see when you observe the onion skin with the 4x and 40x…

A: Onion cells are smaller, thinner, and bricked together. The skin of the onion peel is a single cell…

Q: Briefly describe the principle of the MTT assay and how this assay helps you determine the LC50 of…

A: Testing cytotoxicity of a specific chemical or drug is a routine procedure in several biochemistry…

Q: Please give me a discussion/explanation of (INVITRO STUDIES AND INVIVO STUDIES) part in drug…

A: In vivo studies allow the long-term effects of the drug to be monitored and observed as well as…

Q: As shown , several medical agents are now commercially produced by genetically engineered…

A: Genetically modified organisms play an important role in increasing the production of crops. Crops…

Q: Define all of them: Serenoa repens: A. wrightii: mini–barcode primers: Diagnostic nucleotides:…

A: A drug or medicine is a chemical compound that, when administered, has a biological effect on the…

Q: Choose the option that correctly matches the given columns. Column I Column II Sulphonation…

A: Sulphonation is the process of addition of sulphonic acid in benzene ring. Point mutation is the…

Q: Write the advantages and disadvantages of applying such application in the DNA of an organism. 2.…

A: According to the question, we have to write down the advantages and disadvantages of applying such…

Q: Sticky end ligation is generally preferred over blunt end ligation. Discuss one (1) scenario where…

A: Sticky end and blunt and ligation.

Q: Hi! Can you give an explanation for each sample identity in paragraph form (for the rationale)?…

A: Introduction: Carbohydrates are large macromolecules that contain three essential elements which are…

Q: Choices are in the picture. Choose the primary impact of the given agents to the genetic material.…

A: Heritable change in the genetic material that gives an altered form of a gene is known as mutation.…

Q: Enumeration: level of symptoms in covid-19 suspect, probable, confirmed case Classification:…

A: This question is based on a small description about COVID - 19 under certain specified headings…

Q: SELECT ALL THAT APPLY. Choose the CORRECT statements from the following Enfuvirtide is a novel…

A: Bacteria and viruses are just two types of microorganisms that can cause significant diseases in the…

Q: Which of the following can deaminate Adenine, changing it to hypoxanthine? base analogues…

A: Deamination is a chemical process in which an amino group is eliminated from molecules. Enzymes that…

Q: You are a member of the COVID-19 task force in your district, one of your male clients known to be…

A: Covid-19 is a global pandemic which is related to the respiartory system.

Question

Choices are in the picture.

Choose the primary impact of the given agents to the genetic material.

1. Metronidazole

2. Doxorubicin

3. Mercaptopurine

4. Nitrofurantoin

5. Ciprofloxacin

deletion of genetic information
prevents synthesis of deoxyribonucleotide components
single-strand DNA breakage
double-strand DNA breakage
breakage of H-bonds by inserting chemicals in between
cleaves the prokaryotic DNA
arrrests DNA replication by inhibiting prokaryotic DNA gyrase
arrrests DNA replication by inhibiting eukaryotic DNA gyrase

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Similar questions

Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
During eukaryotic DNA replication, _________ synthesizes short RNA primers. The primers provide a 3'-OH group to which DNA nucleotides are be added by DNA polymerase. DNA gyrase (topoisomerase) DNA helicase DNA ligase primase
DNA Replication Terms _____DNA polymerase III _____Primase _____Helicase _____Lagging Strand _____Leading Strand _____RNA Primer _____Single Strand Binding Protein _____5’ _____3’ _____DNA Ligase _____ Topoisomerase _____Template Strand _____Coding Strand
Indicate the stage of DNA replication when each of thefollowing enzymes is active:a. helicaseb. primasec. DNA polymerasesd. ligasee. topoisomerasef. DNA gyrase
Multiple origins of replication on the DNA molecule of eukaryotic cells serve to Question 41 options: remove any errors in replication that may have occurred create multiple copies of the DNA molecule at the same time shorten the duration of time necessary for DNA replication reduce the number of "replication bubbles" that occur in the DNA double helix during replication assure the correct orientation of the two strands in the newly growing double helix
DNA Replication Explanation Must Include (no essay) Leading strand with 5' and 3' Lagging strand with 3' and 5' - Okazaki fragments Bases (following the base pairing rule) Primase -Primer helicase Polymerase Ligase Parent Strands Daughter Strands New DNAs - semiconservative
Define the following terms:a. processivityb. replisomec. exonucleased. DNA ligasee. replication fork
A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a template for DNA replication, write the sequence of the newly synthesized strand in the direction from left to right in which it will be synthesized.
A biochemist isolates, purifies, and combines in a test tubea variety of molecules needed for DNA replication. Whenshe adds some DNA to the mixture, replication occurs, buteach DNA molecule consists of a normal strand paired withnumerous segments of DNA a few hundred nucleotides long.What has she probably left out of the mixture?(A) DNA polymerase(B) DNA ligase(C) Okazaki fragments(D) primase
Match the statement to the corresponding agent/key player in DNA replication. Some items require more than one answer. choices: Origin of replication Bubble SSBP RPA Sliding Clamp PCNA DNA Pol III Pol ε Pol δ DNA Pol I RNAse H Flap 1 DNA gyrase Pol α DNA helicase Primase Single chromosome Multiple points in chromosomes DNA ligase Not applicable Proof reading in prokaryotic DNA material Joins the Okazaki fragments in leading strand Dissociates after adding the few initial nucleotides in eukaryotes Add nuclecleotides to the site of the removed prokaryotic prime Make primers for the replicative enzymes in eukaryotes Primosome in prokaryotes Proof reading in eukaryotic DNA material Holds the processive enzyme in prokaryotes Removal of prokaryotic primer
A. Create the complimentary strand for the DNA strand below. Make sure to label the parts and direction of the strand. 5’-AACGGTCCAGTCCAAGTTACG-3’ 2. Below is a segment of DNA that is ready to be replicated. Outline the processes that the segment will go through during replication. Make sure to include the names of the enzymes that are involved. AATTGCCTGCTAGTCTCAG TTAACGGACGATCAGAGTC B. DNA: G T A C G C G T A T A C C G A C A T T C RNA: C A U G C G CAU A U G G C U G U A G Codons: AUG - CGC - AUA -UGG - CUG - UAA Anti-codons: UAC - GCG -UAU - ACC - GAC - AUU Amino acids: Met- Arg - Ile - Try - Leu Using the example above transcribe the following DNA strands into m-RNA and translate that strand into a polypeptide chain identifying the codons, anti-codons and amino acid sequence. 3. DNA: A T A C G A A A T C G C G A T C G C G G C G A T T C G G 4. DNA: T T T A C G G C C A T C A G G C A A T…