1. The below strand is a normal polypeptide. Using the below base sequence and amino acids, draw an example of each of the following (show bases and resulting amino acid sequence) a. silent mutation
Q: In problem 2e, how can you identify added mutations?
A: Mutations are changes in the base pairs of DNA that are heritable to the offspring. Mutations caused…
Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…
A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…
Q: The original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the…
A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…
Q: 1. Which one of these indicated groups or bonds: hydroxyl; phosphate; triphosphate; nitrogen base;…
A: DNA replication is a mechanism that involves breaking and building bonds. Replication occurs in 3…
Q: 1. Below is a partial sequence of a guide RNA. The underlined section of the RNA is designed to…
A:
Q: DNA DNA Leading strand mRNA tRNA Amino Acid A T G A A A G T C A T…
A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…
Q: missense mutation: D Adds a base OProduces a different amino acid O Deletes a base O Causes a…
A: The mutation is the change in the original nucleotide sequence of DNA resulting in the change in…
Q: 5' GTGCTAGCGGGAATGAGCTGGGATACTAGTAGGGCT 3 33' САCGATCGCCCTTACТCGАСССТАТGATCАТССCGA 5' Template…
A: The DNA or deoxyribonucleic acid is the genetic material in living organisms. DNA contain genes that…
Q: 1. Below is an amino acid sequence for the following strand of DNA: A G C A A T C C G T C T T G G T…
A: Ans 1 : Point mutation
Q: You are provided with a sample of aardvark DNA. As part of your investigation of this DNA, you…
A: DNA stands for De-oxyribonucleic Acid. DNA is polymer of nucleotides. Nucleotides are molecules…
Q: I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA…
A: "Genes" are the fundamental unit of heredity. They store genetic information in the form of DNA,…
Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…
A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…
Q: 1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of…
A: Defination of the gene :-
Q: 1.Which of the following RNA has a catalytic activity like an enzyme? A. MRNA C. FRNA B. tRNA D.…
A: 1. (C) rRNA 2. (A) deoxythymidine 5'-monophosphate 3. (B) they differ in pitch
Q: Which of these outcomes is most likely to result in a leaky mutation?
A: Introduction Mutations causing partial inactivation rather than complete loss of function in the…
Q: After sequencing a segment of DNA you identify the following sequence: 5…
A: Answer: DNA sequence : It is the genetic sequence or the order of nucleic acids in DNA. DNA…
Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write…
A: The coding strand is complementary to the template strand. The template strand is the DNA sequence…
Q: 1. a) If one DNA segment has the following base composition, 5'-CAGTTAGTCA-3', which of the…
A: I Double stranded DNA the base pairing between the strands occurs as follows: A pairs with T and G…
Q: A+ AT D THA E 1. Identify a nucleotide of DNA. 2. Identify the labelled deoxyribose sugar. 3.…
A: Hi, Thanks For Your Question. Answer : 5 And 6 Are Answered Here, Rest Labelled in Diagram.…
Q: Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the…
A: The change in nucleotide is called a mutation. it could be a point mutation when one nucleotide is…
Q: Can you please do 26, and 27
A:
Q: 1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ mRNA: polypeptide chain:
A: (According to our regulations, we are required to answer only the first question in case of multiple…
Q: a) The following nucleotide sequence is found on the template strand of DNA: 3' - TAC TGG CCG TTA…
A: We are answering four parts For rest of parts pls repost.
Q: The template strand of a gene contains the following sequence: 3'-TAC TTG TCC GAT ATC-5' Following a…
A: Introduction A mutation is a change in the sequence of nucleotides in DNA or RNA. Everyone is…
Q: Please asap Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the…
A: Given: Original DNA template: 3' - ACGGTCAATTTGCTG - 5'
Q: An RNA produced from a fragment of DNA has the sequence of 5'AAUUGGCU3'. The sequence of the…
A: Genetic information in our body is stored as DNA. DNA multiples itself by replication. DNA is used…
Q: Write the sequences of bases in the sense strand of DNA that resulted in the mRNA in Problem .
A: DNA is a double helical molecule, in which two complementary strands are held together with the help…
Q: 1. The two sequences shown below are complementary to each other. T or F GTCGAC CAGCUG
A: Biological macromolecules are those that are made up of large molecules in order to carry out normal…
Q: (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in…
A: The biological process by which the information encoded inside a DNA (deoxyribonucleic acid)…
Q: The Deoxyribonucleic Acid (DNA) is made up of What type of mutation does not affect a proteii 1.…
A: DNA It is a heritable molecule which transfer from parents to their offsprings. It contains all the…
Q: 1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the…
A: Deoxyribonucleic acid (DNA) is a biomolecule found in nearly all living organisms. The structure of…
Q: 3. DNA: TACGGGCCTATACGCTACTACT CA TG GATCGG MRNA: UC Codon: Anitcodon: Amino Acids: 4. DNA: G T…
A: Since we are entitled to answer first question, we’ll answer the question 3 as you have not…
Q: If the first G changes to A what kind of mutation will happen? Show the change in amino acid…
A: When there is an error in the DNA sequence during replication it causes a change in the DNA…
Q: Given: 3' TAC CAG TTA AGC CTC GGT ATC CAG GAT ACG 5' What would be the first 10 bases at the 5' end…
A: DNA replication is the process of new DNA synthesis from the old DNA by semiconservative mode that…
Q: 41. The template strand of a gene has the sequence 3'-TCCCATGAG-5', Which of the following would be…
A: Amino acids are the structural unit of proteins. there are majorly of 20 amino acids which are…
Q: The first 15 bases of the original informational strand of DNA (which continues after what is shown)…
A: Mutation is the change in DNA sequence caused due to various factors. Mutations take place during…
Q: anslation is synthesis of proteins from: t-RNA A. B. C. D. m-RNA r-RNA DNA 41. It is a type of…
A: *We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: plz explain with thorough explanation
A: Introduction : The physical appearance of an organism such as colour, height, which occurs as a…
Q: 5' ACTGAGGATTCGGACAGCAATAGGATG 3' The -2 reading frame of the sequence above gives the following…
A: Answer. A genetic code is a triplet code called a codon. A given amino acid can be specified by more…
Q: 1. What structures are these DNA strand likely to adopt in solution (assuming sufficient salt…
A: A-DNA is one of the possible double helical structures which DNA can adopt. A-DNA is thought to be…
Q: 5’-GGC TAC GTA ACT TGA TAA-3’ (a) mRNA codons that are transcribed from the DNA (b) tRNA…
A: “Since you have posted a question with multiple sub-parts, we will solve the first three subparts…
Q: Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence.…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: You obtained a sample of double-stranded DNA and transcribe mRNA from this DNA. You then analyse the…
A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…
Q: 3. The enzyme responsible for transcribing complementary DNA from mRNA is DNA Polymerase…
A: 3. the process of transcribing complementary DNA from RNA is called as reverse transcription. this…
Q: A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of…
A: A mutation is an abnormal change in DNA sequences that alters the protein product and is one of the…
Q: 5. Create the complimentary strand for the DNA strand below. Make sure to label the parts and…
A: The base pairing rule of DNA is purine always pairs up with pyrimidine. Adenine(A) and Guanine(G)…
Q: 1. Transcribe the DNA strand provided then determine the sequence of amino acids of the gene…
A:
Q: 1) The nitrogenous bases content of a sample of DNA was found to be 3.2% adenine. Determine the…
A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…
1. The below strand is a normal polypeptide. Using the below base sequence and amino acids,
draw an example of each of the following (show bases and resulting amino acid sequence)
a. silent mutation
b. missense mutation
c. nonsense mutation
d. frameshift mutation
5’ AUG – GCC – AGU – GAA - CAU – AAU – AGU – AGA – UAA 3’
Met - Ala - Ser - Glu - His - Asn - Ser - Arg - stop
Step by step
Solved in 2 steps
- 1. Below is an amino acid sequence for the following strand of DNA:A G C A A T C C G T C T T G GT C G T T A G G C A G A A C CThat strand has mutated. It is nowA G C A A C C C G T C T T G GT C G T T G G G C A G A A C CUse your knowledge of mutation and protein synthesis to answer the following questions.What mutation has occurred? A. point mutation B. movement of large section of chromosome C. duplication of entire chromosome D. genetic recombination 2. Will this mutation have a real effect? Why or why not?1. Written below is a DNA seqeunce: G G C A A C T A T C C C G A T T A G C G C Write down the sequence for the complimentary DNA sequence 2. Written below is the DNA sequence of a gene: T A C C T A A G C G C C G G T C A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence 3. Written below is the DNA sequence of a gene: T A C G T G T T T A C T C C A C A T G A T A T C A. Write down the mRNA sequence that would be transcribed from this DNA B. Write down the amino acid sequence that would be translated from the mRNA sequence1. (a) Which of the following statements is TRUE? DNA polymerase moves in a 5 to 3 direction in proofreading and correcting synthesized DNA. RNA polymerase moves in a 5 to 3 direction in synthesizing mRNA. Ribosome moves in a 3 to 5 direction during translation. tRNA moves in a 3 to 5 direction during translation. (b) "In this mutation, most amino acids are replaced due to a deletion of a nucleotide base." missense mutation nonsense mutation silent mutation frameshift mutation
- 1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.1. what will be the mRNA complimentary strand of a DNA sequence AATCGGCTGGGATTA? a. UUAGCCGACCCUAAU b. AAUCGGCUGGGAUUA c. TTAGCCGACCCTAAT d. UUTCGGCTGGGUTTU 2. what will be the amino acid sequence of DNA with a sequence AATCGGCTGGGATTA? a. leucine - alanine - aspartic acid - serine - aspagarine b. leucine - threonine - aspartic acid - serine - aspagarine c. leucine - alanine - aspartic acid - proline - aspagarine d. tyrosine - alanine - aspartic acid - proline - aspartic acid 3. what type of points mutation happened if the mutated DNA sequence is TTA-CAG-CAG-GGT-GGC? a. addition b. deletion c. insertion d. subtitution 4. if the first nitrogenous base "T" will be replaced by "G" ; what will be the resulting amino acid for the first codon? a. isoleucine b. leucine c. tyrosine d. trytophan 5. what type of point mutation happened if the mutated DNA sequence is TTS-CGC-AGG-GTG-GC? a. addition b. deletion c. insertion d. substitution1. The definition of a gene is: a. the sum of genetic information in an organism b. a segment of DNA that carries the genetic information needed to make a protein c. the structure into which DNA is packaged d. a segment of RNA that carries the genetic information needed to make a protein 2. In the double-stranded DNA, the base pairs are: a. G-A and T-U b. G-C and A-U c. A-T and G-C d. A-U and G-C
- The original DNA base sequence is 5’-AGCGTTACCGT-3’; a mutation in the DNA strand results in the base sequence 5’-AGGCGTTACCGT-3’. What can you conclude about the mutation? A. It is a frameshift mutation. B. It is a silent mutation. C. It is a deleterious mutation. D. It may result in a single amino acid change in the protein being coded for by this base sequence.Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?The following fragment of DNA is from the template strand. First determine the amino acids of the protein encoded by this sequence by using the table at the end of this document. Then give the altered amino acid sequence of the proteins that will be found in each of the following mutations: 3’ – TAC AAG GCT CTA TTT GCC ACA ATC – 5’ The nucleotides are numbered 1-24 from left to right. Mutant 1: A transition at nucleotide 9 Mutant 2: A transition at nucleotide 11 Mutant 3: A T to A transversion at nucleotide 15 Mutant 4: A one-nucleotide deletion at nucleotide 7 Mutant 5: A transition at nucleotide 13 Mutant 6: An addition of GGA after nucleotide 6
- I mutation occurs such that the sequence now reads: CTA CTT TTT. A) Transcribe the short DNA sequence. B) translate this short DNA sequence. C) what type of point mutation is this? A mutation occurs such that the sequence now reads: CTA GTC TTT. 1)transcribe this short DNA sequence. 2. Translate this short DNA sequence. 3. What type of point mutation is this?1. Which of the following initially comes directly in contact with the mRNA during translation? a. 60s + 40s b. 50s + 30s c. 40s + 30s d. 60s + 50s 2. Which of the following properties of DNA confers to the presence of 5' phosphate and 3' hydroxyl terminal? a. Double helix b. Polarity c. Complementary base pairing d. Resistance to alkali hydrolysis 3. Which of the following are constant throughout the entire nucleic acid structure? a. Sugar and Phosphate b. A-T + G-C c. A-U + G-C d. Deoxyribose and Ribose1. DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’mRNA:polypeptide chain: 2. a. From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 6 3. a. From the given DNA sequence above, change the third base in codon 4 to show missense mutation. Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 4 4. a. From the given DNA sequence above, change one base in codon 8 to show same sense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:b. Identify the type of base pair substitution that you applied in codon 8 5. Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading…