Compare and contrast fibre types.

Q: Who invented/proposed the use of Punnett square in studying genetics? Give a short description of…

A: Gregor Johannes Mendel was an Austrian monk out Brun Monastery , who studied at Vienna University.…

Q: explain how the deletion of the same set of genes can result in such different diseases. The example…

A: Imprinting is an epigenetic phenomenon connected to Prader-willi syndrome (PWS). A foetus typically…

Q: Part 1 and Pa

A: Introduction: Genetic variation refers to differences in DNA sequence, gene expression, or phenotype…

Q: Based on the observed inheritance pattern and ratio of phenotypes, what are the genotypes of the…

A: Cystic fibrosis is an autosomal recessive Inheritance. It affects the digestive system and lungs. It…

Q: In the binomial naming system, scientific names are written in italics, with the first word…

A: Organisms are classified so that they can be grouped and their characteristics could be studied…

Q: Which one of the following is NOT a characteristic of prokaryotic cells?    Cytoplasm.…

A: INTRODUCTION The oldest single-celled microbes on Earth are prokaryotic cells. Bacteria and archaea…

Q: A genetic mutation leading to under expression of a cell membrane receptor would have the most…

A: Introduction :- Genetic mutation refers to a permanent change in the DNA sequence that makes up a…

Q: In a 10-month-old child, excessive excitability, sleep disturbances, reduced muscle tone, delayed…

A: The condition of excessive excitability, sleep disturbances, reduced muscle tone and delayed…

Q: What is the relationship between the structures (tissues and cells) and their location with respect…

A: In plants different types of tissues are found at different locations. These plants perform…

Q: If a culture of E. coli you are tracking grows from 5 x 103 cells/ml to 9 x 107 cells per ml in 4…

A: E Coli:   In the lower intestine of warm-blooded organisms, Escherichia coli, also known as E. coli,…

Q: What came first, the ribosome or the protein?  explain in detail why

A: Ribosomes are essential components of cells, responsible for synthesizing proteins from the…

Q: Choose which one Hypotonic, Hypertonic, Isotonic

A: Introduction: The cell membrane, also known as the plasma membrane, is a thin, semi-permeable…

Q: Phenylketonuria (PKU) is an autosomal recessive disease that results from a defect in an enzyme that…

A: With the chemical formula C 9H11NO2, phenylalanine (Phe or F) is an essential -amino acid. It can be…

Q: What is a stele and how did it evolve in plants over time?

A: Introduction :  The stele is the central region of the roots and stems. Pericycle, pith, and…

Q: Describe what the dna looks like

A: DNA extraction is a laboratory technique used to isolate and purify deoxyribonucleic acid (DNA) from…

Q: Nonalcoholic fatty liver disease is thought to be exacerbated by a diet heavy in sugar. Explain?

A: Introduction :- Nonalcoholic fatty liver disease (NAFLD) is a condition in which excess fat…

Q: Fill in the blank The ______ acts to position RNA polymerase II for transcription initiation. The…

A: Introduction :- Histones are proteins that play a crucial role in packaging and organizing the DNA…

Q: draw a punnett square, both parents are mixed hybrids, name the 4 possible offspring and the…

A: The above question asks for the construction of a Punnett square, which is a graphical…

Q: Explain how oxidation of a substrate proceeds without oxygen.

A: “Since you have posted multiple questions, we will provide the solution only to the first question…

Q: There may be more than one correct answer for each Which of the following motifs can be found in…

A: Introduction :- A motif is a short, recurring sequence of nucleotides in DNA or amino acids in a…

Q: Identify three areas or fields of concern for Biomedical Engineer. Briefly explain each

A: A biomedical engineer is a professional who applies engineering principles and design concepts to…

Q: can you explain this solution using the concepts of upregulation and down regulation

A: Alcohol is a major depressant of central nervous system. It decreases the overall activity of CNS…

Q: Imagine three islands, each with a population of frogs. There are approximately 1,100 frogs on…

A: Introduction :- Genetic drift is a random process that can result in changes to the genetic…

Q: Explain why the phenotypic frequency of the tuskless trait is increasing in the African elephant…

A: The change in the character of an organism over generations is called evolution. The evolution of…

Q: You perform a ten-fold serial dilution of a bacterial culture to determine the number of colony…

A: INTRODUCTION Serial dilution is a laboratory technique used to create dilutions with a precise and…

Q: Skin color in humans is determined by a polygenic inheritance system, possibly involving as many as…

A: Introduction :- Gametes are reproductive cells, such as sperm cells in males or egg cells in…

Q: There can be more than one correct answer Which of the following methods can seperate proteins…

A: INTRODUCTION All living things require chemicals known as proteins. They are composed of amino…

Q: What does the term transformative healthcare policy formulation mean and what are some examples?

A: Introduction Healthcare is a system of services, institutions, and practitioners that are dedicated…

Q: What structure provides oxygen to the growing organism? placenta uterine wall embryonic disk neural…

A: Fertilization is the process of fusion of male and female gametes that takes place inside the…

Q: ’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ Fill in the complimentary DNA strand and…

A: Watson and Crick elucidated in 1953 , the famous double stranded structure of the DNA molecule and…

Q: Suppose an organelle contains 0.02 M KCI and 21 mM NaCl. How many grams of sucrose would you need…

A: When plant organelles are isolated, the osmotic pressure inside the organelle can fluctuate due to…

Q: 35. Which of the following occur during processing of pre-mRNA? a.) removal of exons b.) removal of…

A: The process of transcription takes place in nucleus,in which mRNA is synthesised from the…

Q: Give the result(s) of the experiment in "MicroRNAs Control De Novo DNA Methylation Through…

A: INTRODUCTION MicroRNAs (miRNAs) are a class of small, single-stranded non-coding RNAs that regulate…

Q: What is the genetic mechanism behind BWS and RSS in Parental imprinting?

A: A subset of genes are expressed differently depending on the parent, a phenomenon known as genomic…

Q: Jewel Case has blood type A Rh+, and her husband Derek Case has blood type B Rh+. They have just had…

A: Blood group of an individual can be determined by presence absence of antigen on RBC surface and…

Q: The function of a neurotransmitter is:

A: Introduction  A neurotransmitter is a chemical messenger that plays a crucial role in the…

Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…

A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…

Q: In a child's genetic traits influence their social and physical environment. active gene-environment…

A: The environment may alter genes in a variety of ways. Epigenetic factors are variables that exist…

Q: How is an epidural administered? Oby taking a pill through a breathing mask or tube Oby intravenous…

A: Ans: Epidural is a procedure in which the local anaesthesia is injected into the space around the…

Q: You have a 300 mOsM cell, and you place it in a solution that is 400 mOsM. Highlight the correct…

A: The tonicity of a cell is dependent on the solute concentration inside the cell and outside the…

Q: 9. Draw the three different types of transporter proteins used in active transport. After doing…

A: The movement of substances against an electrochemical gradient through a cell membrane requires…

Q: In experiments using polymerase chain reactions (PCR), it is often more difficult to amplify through…

A: Introduction :- Polymerase Chain Reaction (PCR) is a laboratory technique used to make many copies…

Q: Gloc Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia Triplodon Etheria Chambardia…

A: Introduction: Glochidia are the larval stage of freshwater mussels, including Quadrula mussels. The…

Q: Explain what would occur during fetal development to an XY individual with a mutation causing a…

A: Introduction: Disorders of sex development (DSD) refer to a group of conditions that affect the…

Q: PKU is a recessive disorder based on a single mutant gene. Consider that Noor is a carrier, but her…

A: Phenylketonuria is a rare genetic disorder which affects the way the body processes an amino acid…

Q: Punnett square

A: Punnet square: It is defined as the graphical representation or square diagram which is used to…

Q: Which of the following are part of the muscle contraction process?(More than one answer may be…

A: Muscle contraction is the basis of all skeletal movements. Skeletal muscles are composed of muscle…

Q: Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia Triplodon Etheria Chambardia…

A: Introduction Evolution is the process by which species of organisms change over time through natural…

Q: Calculate the CFU per m 1 -0.000.000 SAMPLE 1mi Conf TNTC imi TNTC 400 35 Im

A: CFU/ml is determined by multiplying the total number of colonies by the dilution factor and dividing…

Q: If the mutation occurred in Jonathan's somatic cells when he was in his 30's, what type of alleles…

A: A neurodegenerative condition that is primarily inherited is Huntington's disease (HD), also known…

Learning and memory

Learning is defined as a relatively permanent and irreversible adaptive change in behavior. It always results from experience. The ability of an organism to store and recall the effects, sensations, and knowledge gained through learning and experience is called memory.