explain how the deletion of the same set of genes can result in such different diseases. The example for this question being Prader-willi syndrom and Angelman syndrome. In your answer, be sure to discuss the role of genetic imprinting and epigenetics.
Q: Briefly explain WHY a 5 7-methylguanosine cap is only added to mRNA, not to tRNA or rRNA. (Please…
A: Introduction DNA is a self replicating molecule. Transcription is a process by which mRNA is…
Q: Calculate the amount of GFP in grams produced in the 25-L fermentation used to generate cells for…
A: The green fluorescent protein is an autofluorescent recombinant protein extracted from the jellyfish…
Q: . What are differences between prokaryotes and eukaryotes?
A: Prokaryotes consists of nucleoid and it is not membrane bounded. Nucleus present in prokaryotes is…
Q: 18. What is a codon? 19. List each codon from the mRNA molecule in # 18 (put a dash between each…
A: The sequences in DNA or RNA constitute nucleotides that are made up of bases (adenine, thymine…
Q: For the following traits, what information must you have in order to predict the phenotype of an…
A: Answers : A. The maternal influence can be seen in the coiling of snails. When there is a maternal…
Q: True False Glochidia morphology (shape) Mytilus Mercenaria Neotrigonia Velesunio Hyridella Castalia…
A: The history of the events by which species or other taxa have evolved from a common ancestor is…
Q: rial dilutions: two 10-fold dilutions, followed by a 5-fold dilution, followed by 2-fold dilution.…
A: given that there are 35 cells but volume is not mentioned so let's assume 35 cells are present in 1…
Q: 14. Assume you have the following stock solutions: 1 M Tris-HCl (pH 8.0) 0.5 M EDTA (pH 8.0) Perform…
A: Q.Ans:- Explanation:- Given that there is a need to form 30 ml of TE buffer. TE buffer is a solution…
Q: Which of the following is NOT true of transfer RNA (tRNA)? Each individual molecule of tRNA can…
A: Introduction tRNA (Transfer RNA) is a type of RNA molecule that plays a crucial role in the process…
Q: 20 known diseases that are transmitted through the food we eat. True false?
A: INTRODUCTION A disease is a medical condition, typically caused by an infectious agent, which…
Q: Which of the following statements regarding contraction of skeletal muscle cells is NOT true More…
A: The area between one Z line and the next Z line is known as a sarcomere. A myofibril is made up of…
Q: Which of the following is NOT true about transduction? O The bacteriophage's own viral DNA is the…
A: Bacteriophage transduction is a type of genetic transfer in which bacterial DNA is transmitted from…
Q: After a meal that contains carbohydrates, blood glucose levels usually rise gradually as…
A: Introduction : Carbohydrates are a large group of naturally occurring organic compounds that are…
Q: Describe how changes in the ladybugs'environment may influence their survival and/or reproduction.
A: Ladybugs belong to the phylum arthropods and are natural killers for many herbivorous insects. They…
Q: CFU/mL
A: Bacteria grow on solid media as colonies. When the bacterial cell is alone, we cannot see it with…
Q: Provide the major types of transport that move substances across the cell membrane.
A: Introduction : The cell membrane or plasma membrane completely seprates the interior of a cell from…
Q: ment 1 (Chapter 1-3) i Click and drag each label to identify which phase of meiosis it describes. A…
A: Meiosis is a type of cell division that occurs in sexually reproducing organisms and results in a…
Q: How did they get the diameter of 4.25
A: Diameter is very much related to the magnification of the microscope. Magnification is added when…
Q: Explain the Glycemic Index (GI) and how it impacts the digestion of carbohydrates within the human…
A: For foods containing carbohydrates, there is a rating system called the glycaemic index (GI). It…
Q: In what ways do steroid hormones differ from peptide hormones? More than one aswer may be correct.…
A: 12.Hormones are chemical messengers of low molecular weight which are released in very trace amounts…
Q: Which of the following is NOT correctly matched? Sterilization - destruction or removal of all forms…
A: According to Bartleby guidelines only the 1st question can be answered. Please repost the remaining…
Q: QUESTION 1 The energy for photosynthesis is provided by: A. ATP OB. sound C. light OD. batteries
A: Introduction :- Photosynthesis is the process by which green plants and some other organisms convert…
Q: Label the dna
A: Introduction: DNA (Deoxyribonucleic Acid) is a long polymer that stores and transmits genetic…
Q: List any phenotypes (e.g., physical or behavioral) that might differ between the average person who…
A: Introduction Twins are two offspring produced by the same pregnancy. There are two types of twins:…
Q: What is a stele and how did it evolve in plants over time?
A: Introduction : The stele is the central region of the roots and stems. Pericycle, pith, and…
Q: You have a 300 mOsM cell, and you place it in a solution that is 400 mOsM. Highlight the correct…
A: The tonicity of a cell is dependent on the solute concentration inside the cell and outside the…
Q: A sexually reproducing diploid organism has 12 chromosomes in G₁. % The minimum number of unique…
A: there are two processes in the meiosis that results in unique gametes, crossing over and independent…
Q: What is the pathway involved in blood clot formation? What are the possible disorders? How many…
A: NOTE: Since you have posted a question with multiple sub parts, we will provide the solution only to…
Q: explain the goals of the ACA ? In the context of reproductive health policy specifically and health…
A: 2010 saw the enactment of the Affordable Care Act or ACA, commonly referred to as Obamacare.
Q: Measuring gene expression of a reporter gene (e.g. gfp) under the control of an unknown promoter…
A: INTRODUCTION Gene expression is the process by which the genetic information encoded in DNA is…
Q: 11. Why is the control of gene expression so critical for all living organisms? To conserve energy…
A: 11) Why is the control of gene expression so critical for all living organisms? Ans ) all the above…
Q: Which statement about pits is FALSE? O a. Aspiration of a pit pair is irreversible. O b. The margo…
A: introduction In plant pits means the thinner portions of the cell wall and through pit cells can…
Q: How is a organizational policy created to lessen the outcomes of infectious disease exposures on…
A: Introduction Human health refers to the physical, mental, and social well-being of an individual.…
Q: The answer above was what I was looking, but none other question I submitted gave me numerous…
A: DNA act as genetic material which have the most of the information about growth and development of…
Q: INSTRUCTION: - Answer the question properly - Discuss your answer - Do not copy in Google or here in…
A: The goal here is to evaluate the relevance of animal anatomy and physiology and how it connects to…
Q: Place levels of anatomical organization in the correct order from lowest to highest
A: Anatomical organization refers to the fundamental levels of the body which increases in complexity…
Q: Trade secret protection can be an effective strategy in an environment where patent protection is…
A: A patent can protect inventions, innovations. Trade secret protection confers owners the right to…
Q: 5’ GGACCTATCAAAATCCTTAATGCGCTAGGATAGCTAACGCATCCAC3’ The template strand is shown. The +1…
A: DNA and RNA govern transcriptional activity or the mechanism by which a gene's information is used…
Q: For each of the following statements regarding protein import into mitochondria, indicate whether it…
A: Mitochondria are double-membraned bound organelles seen inside the cell. They are the site of energy…
Q: Which of the following represents the correct order of the phases of mitosis?
A: A cell's growth and division are accompanied by a series of processes known as a cell cycle. A cell…
Q: 35. Which of the following occur during processing of pre-mRNA? a.) removal of exons b.) removal of…
A: The process of transcription takes place in nucleus,in which mRNA is synthesised from the…
Q: What biomolecule composes RNA pol II and TFs?
A: Introduction: The process of gene expression uses genetic information stored in the DNA sequence to…
Q: List tree synapomorphies shared by extant filter-feeding whales.
A: Since they used to filter its food via baleen plates, whales are known as "filter feeders." They…
Q: d. You have a 10 gram/ml. stock solution of protein. To make 50mL of 25 mg/ml solution, add, of…
A: We are given a 10gm/ml stock solution of protein. We have to makea 50 ml solution with 25mg/ml…
Q: Explain what would occur during fetal development to an XY individual with a mutation causing a…
A: Introduction: Disorders of sex development (DSD) refer to a group of conditions that affect the…
Q: Using the figure below for the areas labeled "1" give the name of the axis Yaw and what it controls…
A: The motion of fish has six degrees of freedom because the movement along each of the three axes is…
Q: 22. Which of the following is not a reason why the human population has grown exponentially? a.…
A: Exponential growth of human population: It is defined as the rapid increase in the population with…
Q: Electrophoretic-Mobility Shift Assay DNA affinity chromatography Immunoprecipitation DNA footprint…
A: Introduction DNA replication is the process by which a cell makes a copy of its genetic material,…
Q: In sequencing, dideoxyribonucleotides (ddNTP) are used that terminate the amplification. Why do they…
A: Introduction : DNA sequencing is the process by which the specific sequence of the four nucleotide…
Q: Pigeons display a high color variety, here we try to understand the genetic basis of mixed red &…
A: This question explores the genetic basis of mixed red and black stippling of the feathers (kitey)…
Please explain how the deletion of the same set of genes can result in such different diseases. The example for this question being Prader-willi syndrom and Angelman syndrome. In your answer, be sure to discuss the role of genetic imprinting and epigenetics.
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Why is it difficult to study whether a trait is due to epigenetic changes or due to something else? (Hint: What are the other things that may cause disease?) (Minimum of 2 complete sentences.)Using coat color in mice and the development of female honeybees as examples, explain how dietary factors cause epigenetic modifications and thereby lead to phenotypic effects.Using coat color in mice and the development of female honeybees as examples, explain how dietary factors can cause epigenetic modifications, leading to phenotypic effects.
- Discuss the similarities and differences of phenotypic variations that are caused by epigenetic gene regulation versus variation in gene sequences (epigenetics versus genetics).Often, the physical characteristics of genetically identical twins become increasingly different as they age, even at the molecular level. Explain why this is so from the point of view of epigenetics.Which of the following is an example of epigenetic modulation? a) Ionization-induced DNA damage b) Single nucleotide polymorphism (SNP) c) Free-radical induced DNA damage d) Histone modifications of DNA
- Does genetic analysis by ASO testing allow for detection of epigenetic changes that may contribute to a genetic disorder? Explain your answer.What degree of differences would you expect to see in the DNA base sequences and epigenetic marks of monozygotic twins? a. Similar differences in DNA base sequence and epigenetic marks b. Greater differences in DNA base sequence than epigenetic marks c. Greater differences in epigenetic marks than DNA base sequence d. No differences in either DNA base sequence or epigenetic marksDiscuss how epigenetic processes can be modified by environmental factors.
- One unexpected result of the sequencing of the human genome was the finding that mutations in a single gene can be responsible for multiple distinct disorders. For example, mutations in the RET gene can cause two different types of multiple endocrine neoplasias, familial medullary thyroid carcinoma, and Hirschsprung disease. How do you think mutations in a single gene can have such diverse effects?Which of the following is a correct statement about epigenetics? Group of answer choices Increased methylation of histones = decreased gene expression Decreased acetylation of histones = increased gene expression Adenine nucleotides are often directly methylated in vertebrate genomes Guanine nucleotides are often directly acetylated in vertebrate genomesA scientist does an experiment in which she removes the offspring of rats from their mother at birth and has her genetics students feed and rear the offspring. Assuming that the students do not lick and groom the baby rats as the mother rats normally do, what long-term behavioral and epigenetic effects would you expect to see in the rats when they grow up?