Complete the box below: Convert the following template strand of DNA bases into its complementary mRNA molecule. Next translate the DNA into a polypeptide chain of amino acids using the Table above. CAATATGGAAGCCGACTCACCCTAATT
Q: A newly-identified relative of Staphylococcus is causing great concern at the Center for Disease…
A: The question provides data from experiments in which DNA from donor cells was used to transform…
Q: Carrying Capacity and the Bison of Yellowstone National Park The following adapted from an article…
A: We may conclude from an analysis of the graph and the available data that bison are not leaving the…
Q: Some organs belong to more than one body system and their function depends on the body system to…
A: In the human body, organs play vital roles in maintaining overall health and functionality. While…
Q: A PhD student leaving for vacation has asked an undergraduate student to perform daily media changes…
A: A mathematical model known as Michaelis-Menten kinetics is used to explain enzyme kinetics. It is…
Q: If the trait shown in the pedigree presented follows an X-linked mode of inheritance, what is the…
A: Pedigree: In terms of genetics, a pedigree is a diagram demonstrating the manner in which a trait or…
Q: Many animals (including some lizards) shift between lighter and darker coloration, depending on…
A: The capacity of an organism to keep its core body temperature, which is 37° C (98°F), within an…
Q: Clines in body size have been observed in many species, such as the latitudinal cline in moose shown…
A: A cline is a steady fluctuation or change in a feature or attribute along a gradient in geography or…
Q: If the mRNA produced had the sequence ACGCGU,what would be the tRNA anticodo sequence?
A: mRNA is a messenger RNA that is synthesized from the DNA by a process called transcription. The tRNA…
Q: Which of the following nutrients in food are most efficiently metabolized by microflora of ruminant…
A: The microflora of ruminant animals refers to the complex community of microorganisms, including…
Q: Which of the following is true of physical fitness? Multiple Choice O O It is a measure of the…
A: Fitness includes any type of exercise that activates the body's systems and keeps them in a specific…
Q: 8. The DNA shown below will be used as a template for a PCR reaction. The arrows below the template…
A: A DNA strand can be amplified several times using the Polymerase Chain Reaction (PCR) method. It is…
Q: Which of the following animals would be most likely to be able to digest non-starch polysaccharides?…
A: Polysaccharides are complex carbohydrates composed of long chains of monosaccharide units linked…
Q: List two disorders caused by lifestyle choices fro each system: a.) digestive b.) respiratory c.)…
A: "Lifestyle choices can significantly impact our health, leading to the development of various…
Q: Question 11 ave Answer A testscross is performed on an individual to exame three linked genes. The…
A: If the genes are located on the same chromosome then they are classified as linked genes and in that…
Q: The figure below shows the fomation of a bulky-DNA adduct with benzopyrene which is a toxicant…
A: The diagram below depicts the creation of a bulky-DNA adduct with benzopyrene, a toxicant present in…
Q: Tissue Type Tissue Type
A: Muscle tissue is a specialized type of tissue that is responsible for the contraction and movement…
Q: I need help determining the FOV for the objective microscope, ocular lens please.
A: FOV (Field of View) = FOV Objective Lens / Total MagnificationFirst, we need to find the FOV of the…
Q: If the healthcare team disconnects the respirator and let's the patient die, they will be…
A: The principle of veracity is a moral principle that identifies all knowingly wrongful statements as…
Q: biotechnology lab class : 1. The bacterial streaking on antibiotic containing agar plates has been…
A: Using restriction endonucleases, a type of enzyme, restriction digestion, also known as restriction…
Q: 1. What techniques are used in the panel A,B C in figure 1? 2. What does the data show?
A: The provided figure, Figure 1, presents experimental observations related to gene expression errors…
Q: the highlighted structure is the ??
A: The adrenal gland is a small, triangular-shaped endocrine gland located on top of the kidneys,…
Q: In an ant colony in which the queen is mated with 2 males, the average relatedness of a female…
A: The degree of genetic relatedness between two people is measured by the coefficient of relatedness.…
Q: II. Given the following pedigree below, use Punnett squares for each of the following possibilities:…
A: The inheritance pattern shown in a family tree is known as the pedigree mode of inheritance. It…
Q: Name the functions, food sources, and deficiency and toxicity symptoms for your selected nutrient:…
A: Sodium is special type of chemical element of alkali metal group. Sodium is very soft and silvery…
Q: Give only typing answer with explanation and conclusion to all parts Two true-breeding varieties of…
A: The character shown in an individual organism depends on the genetic makeup of parents. The…
Q: Cucumbers and melons are both members of the genus Cucumis, which includes members with distinct…
A: In the study of cucumbers and melons, scientists aimed to enhance disease resistance in a new fruit…
Q: Which organ or organs produces the enzyme amylase? Select one: a. Pancreas only b. Stomach only…
A: In the process of breaking down carbs, an enzyme called amylase is used. Complex carbohydrates such…
Q: maximum specific growth velocity
A: This refers to the process of growing and maintaining the microorganisms (bacteria, yeast, or fungi)…
Q: Okay so I’ve been doing my biology homework and I’ve been stuck for the past hour trying to figure…
A: In this circumstance, we need to discover the absorbance at 5 minutes and 10 minutes by employing a…
Q: After streaking microbial culture on agar plates and observing colonial growth, TMTC usually…
A: TMTC ("Too Many to Count") is a condition in which the number of colonies on an agar plate exceeds…
Q: Case 3: If the healthcare team refuses his request and keeps him on the respirator , they will be…
A: if the healthcare crew refuses the affected person's request to be taken off the respirator and…
Q: Consider a situation where the electrical potential inside a cell is 173 mV, the electrical…
A:
Q: Which of the following would you predict to be the consequence of Vitamin B12 deficiency in ruminant…
A: Ruminant animals like cows, sheep, and goats, have a unique digestive system with a specialized…
Q: The very fact that insects exist raises the question, "why?" The question is, how can a bug get…
A: The presence of insects raises intriguing questions about their existence and how they manage to…
Q: 2-Explain how reflexes came into play
A: Reflexes are involuntary and automatic responses to certain stimuli that help organisms react…
Q: A flock of sheep have 140% lambing. The goal is increased fleece weight with smaller fiber diameter.…
A: Given informationThe flock of sheep has 140% lambing.The number of ewes mated= 960 The ratio of ewes…
Q: Characters Sponge Jelly X X Cells with flagella Bilateral symmetry Mesoderm Head develops first Anus…
A: The system of naming and categorising animals is known as taxonomy. The study of links between…
Q: Give only typing answer with explanation and conclusion Identify the role of natural selection in…
A: The evolution of skin color in human populations is a fascinating subject that has been shaped by…
Q: Suppose i want to prepare or manufacture 1 litter of hand wash, for this can you please provide me a…
A: SOP is an abbreviation for Standard Operating Procedure. It is a detailed step-by-step guide that…
Q: The remaining questions go together. In a species of collared lizard (Crotaphytus collaris), long…
A: Inheritance refers to the process by which genetic information is passed from one generation to the…
Q: In one reaction used for DNA sequencing 2,3 dideoxy-cytosine tri-phosphate is added to the reaction…
A: In the case of 2,3 dideoxy-cytosine tri-phosphate (ddCTP) it is specifically used to terminate DNA…
Q: 7. A boy born with colour blindness has a dad who is colour blind but his mom is not. He is most…
A: Color blindness is often an X-linked recessive trait. This means that the gene responsible for color…
Q: Provide three reasons why did Mendel choose pea plants as an experimental model?
A: Gregor Mendel, widely recognized as the father of modern genetics, conducted groundbreaking…
Q: Ob) many solvents, but only one solute c) many solvents and many solutes.
A: option a is correct
Q: Case 1: Charles is a phlebotomist who works in the positions office laboratory. One morning shortly…
A: Since you have posted multiple questions, we will provide the solution only to the case 1 questions…
Q: Could the trait presented in the pedigree shown be caused by an X-linked recessive allele? Why or…
A: X -linked recessiveIn X -linked recessive inheritances, females should carry both diseased X…
Q: Which are reasons why endospores can resist death by moist heat (select the 2 correct answers). They…
A: Endospores are the resistant spores produced by bacteria. These are considered cryptobiotic because…
Q: Defects in which enzymes enumerated below would impair the repair of the sequence below in…
A: Based on the provided sequence, the following enzymes would impair the repair of the sequence in…
Q: Explain how to calculate your stroke volume and cardiac output.
A: The human heart is a remarkable organ responsible for pumping blood throughout the body, delivering…
Q: Which of the following describes the function of lipoprotein lipase? Select one: a. It catalyzes…
A: Lipoprotein lipase (LPL) is an essential enzyme involved in lipid metabolism and the transportation…
Complete the box below:
Convert the following template strand of DNA bases into its complementary mRNA molecule. Next translate the DNA into a polypeptide chain of amino acids using the Table above.
CAATATGGAAGCCGACTCACCCTAATT
Trending now
This is a popular solution!
Step by step
Solved in 3 steps with 1 images
- The following are sequences from three different alpha helices found inhuman proteins: hBak(72-87): GQVGRQLAIIGDDINR hCB1(196-210): VTASFTASVGSLFLT hCB2(248-262): LVLAVLLICWFPVL Classify each of these three helices as either a) mostly hydrophobic, b)mostly hydrophilic, or c) amphipathic. Use the helical wheel to explainyour answers. Given the character of these helices, in which part of the protein wouldyou expect them to reside?using, 3’ TGAGGCGCTAGGCCAAGCGGTAAGGATGCATGGTCGTGGTAG , What would be the resultant type of error on the amino acid chain?Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′
- In a mixed heteropolymer experiment, messages were createdwith either 4/5C:1/5A or 4/5A:1/5C. These messages yielded proteinswith the amino acid compositions shown in the followingtable. Using these data, predict the most specific coding compositionfor each amino acid.4/5C:1/5A 4/5A:1/5CPro 63.0% Pro 3.5%His 13.0% His 3.0%Thr 16.0% Thr 16.6%Glu 3.0% Glu 13.0%Asp 3.0% Asp 13.0%Lys 0.5% Lys 50.0% 98.5% 99.1%A molecule of composition5′-AAAAAAAAAAA-3′3′-TTTTTTTTTTTTT-5′is replicated in a solution containing unlabeled (notradioactive) GTP, CTP, and TTP plus adenine nucleoside triphosphate with all its phosphorus atoms in theform of the radioactive isotope 32P. Will both daughtermolecules be radioactive? Explain. Then repeat thequestion for the molecule5′-ATATATATATATAT-3′3′-TATATATATATATA-5′Referring to the genetic code presented in Figure , give the aminoacids specified by the following bacterial mRNA sequences. Q. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′
- Consider the peptide Trp-Arg-Glu-Cys-Gly-Tyr. For the drawings requested below, please show them in zig-zag style, from amino to carboxy terminus, with correct stereochemistry Draw the predominant form at pH = 2 Draw the predominant form at pH = 5 Draw the predominant form at pH = 7 Draw the predominant form at pH = 12On average, how many phosphoanhydride bonds (P;-P; bonds) are directly hydrolyzed in thecourse of synthesizing a 200 amino acid protein? Assume that you begin with the mature mRNA,ribosomal subunits, tRNAs, free amino acids, and all necessary factors.Please help! Sketch a titration curve of the peptide Ala-Tyr-Gln-Met-Asp-His from pH=0 to 14 up to 5 equivalnets of KOH (Please type answer)
- A peptide with 12 amino acids has the composition (not sequence) Asp 2Cys 2Glu 2Leu 2Ser 2Tyr Val. It also has Ser as the N-terminal residue and Cys as C-terminal. Partial acid hydrolysis gave these peptide sequences: (a) SerLeuTyr (b) TyrCys (c) LeuTyrGlu (d) GluLeuGlu (e) SerValCys (f) CysSerVal (g) GluAspTyr . What is the peptide sequence?PLEASE MAKE THE DR BRUJIN GRAPH From these k-mers construct a de Bruijn graph and determine the sequence of the contig. AGCG ATCT ATGA ATGG ATTC CCCT CCTG CTCT CTGA CTGC CTTT GAAG GATT GCGT GCTC GTTC TATG TCAT TCTA TCTT TGAA TGAT TGGA TGTT TTCA TTCC TTTCHbS results from the substitution of valine forglutamic acid at the number 6 position in the b chainof human hemoglobin. HbC is the result of a change atthe same position in the β chain, but in this case lysinereplaces glutamic acid. Return to the genetic code table and determine whether single-nucleotide changes can account for these mutations. Then view and examine the R groups in the amino acidsglutamic acid, valine, and lysine. Describe the chemicaldifferences between the three amino acids. Predict how thechanges might alter the structure of the molecule and leadto altered hemoglobin function.