Complete the tables below to determine the polypeptide chain of a functional and mutated hemoglobin gene. 1st Six Codons of the Functional Hemoglobin Gene DNA GT G C AC CT GACT C C T G A G mRNA Polypeptide 1st Six Codons of the Sickle Cell Hemoglobin Gene DNA GT G C AC CT GACT C C TGT G mRNA Polypeptide Phe Gly (G) Leu Glu (F)
Q: The afflicted individuals in the pedigree have dysphasia-like condition. The gel below shows results…
A: A verbal disorder known as dysphasia or aphasia. It has an impact on how you speak and comprehend…
Q: In a population of snapdragons, at the locus controlling flower color you find that 0.2 are AA, 0.65…
A: Given: AA = 0.2 Aa = 0.65 aa = 0.15 Need to find the inbreeding coefficient.
Q: Name the method based on a conception, that the diminishing of toxic substances quantity in the…
A: To identify: To identify the correct sorption of toxic substances quantity in the stomach and…
Q: Provide the best match possible. A. differentiates into a fruiting body called a sorocarp B. have…
A: Giardia lamblia comes in two forms: trophozoites, which are active, and cysts, which are inert.
Q: 10 is missing
A: DNA or deoxyribonucleic acid is the genetic material in living organisms which is made up of…
Q: VARIATION IN POPULATION DENSITY OF BEETLES 401 35 30- Species A Species B .** Species C 25 20+ 15…
A: Introduction Evolution is the process of a species' traits changing over numerous generations…
Q: Why is a strong reducing agent, such as NaBH4, not suitable for use in the conjugation of an…
A: The NaBH4 is a strong reducing agent and can reduce aldehyde, ketones and the acid chlorides into…
Q: What kind of membrane proteins trigger a change in cellular activity in response to a stimulus?
A: Introduction:- Membrane proteins are embedded in lipid bilayer and perform many functions important…
Q: lution. Please answer all question that is just one sentence each question. PART 2 1. Why is it…
A: Need to include the effects of natural selection: There is a boost for ecosystem productivity in…
Q: SHORT ESSAY. Answer the following questions briefly. Write your answers on the space provided. Limit…
A: INTRODUCTION Thermoregulation This is the process by which mammals maintain their body temperature.
Q: Question: For bacterial gene transfer via conjugation to occur, the host bacterium must possess a…
A: The conjugation of the bacteria plasmids is called bacterial conjugation and in this here is direct…
Q: PRACTICE PROBLEMS AND REVIEW QUESTIONS 1. What is the total magnification of an object if the ocular…
A: Magnification is the ability of microscope to produce an image of an object at a scale larger or…
Q: How can one cell give rise to different types of cells? Support your explanation with embryologic…
A: Introduction A cell is a cytoplasmic mass that is outwardly bound by a cell membrane. Cells are the…
Q: ACP is specific of the pancreatitis O True O False is defect inglucuronyl transferase O Gilbert…
A: Acute pancreatitis is a pancreatic inflammatory illness that can occur all at once or in relapses.…
Q: A pregnant woman is carrying a triplet inside her womb. They want to determine the number of boys or…
A: Probability of having a boy or a girl is always 1/2.
Q: 7. How could genetic engineering be of use to humans? Describe at least 2 different uses.
A: Science is humanity's greatest blessing. It has altered human existence; nothing finer could have…
Q: Which is FALSE about the protein that regulates tryptophan biosynthesis? O The recognition helices…
A: The trp operon, found in E. coli bacteria, is a group of genes that encode biosynthetic enzymes for…
Q: All of the following are benefits of breast feeding EX a) The baby will receive complex…
A: In infants below 6 months of age, it's advised that breastfeeding is to be followed. Breastfeeding…
Q: CLASSIFICATION EXAMPLES FEATURES Domain Archaea Kingdom Phylum Class Order Family Genus Species…
A: Classificiation can be defined as a arrangemant of taxa on the basis of certain observed…
Q: Functions of cell division: 1. 2. 3. All somatic cells (body cells of plants and animals) go through…
A: Mitosis is equational division. Meiosis is reductional division.
Q: The most likely site for food contamination is: a) a person's own kitchen O b) the grocery store c)…
A: Introduction Food contamination:- It refers to food that has been corrupted with another substance –…
Q: 8. If the molecular weight of E. coli DNA is taken as 2.7 x 10° and the average molecular weight of…
A: Nucleic acids are essential for all forms of life and are found in all cells. Nucleic acid comes in…
Q: How are antibodies to Salmonella H antigen produced? A) antibodies to H antigen are isolated from…
A: Antibodies are the proteinaceous substances which are produced by the B cells of the immune system.
Q: 2. A nursing mother who has an alcoholic drink secretes alcohol into her milk for two to three hours…
A: Alchohol consumption leads to decrease in hormone production.
Q: Define the term anthropometrics
A: The study of the human body and its movement, which frequently includes research into human…
Q: Weeds that grow and complete their life cycle under wet or dry condition of the soil. Lowland…
A: Weed A weed is a plant growing where is not wanted. It is unwanted plant. It is extremely noxious,…
Q: The mating below shows the sex chromosome found in two parents and their resulting offspring. FMR1…
A: Introduction An organism's genotype is its entire set of genetic material. The alleles or variants…
Q: A diabetic's blood sugar cannot be controlled because their pancreas can not produce enough insulin.…
A: Diabetes is a condition when the person cannot secrete enough insulin to regulate glucose levels in…
Q: Consider the similarities and differences in the reproductive cycles (haplontic, diplontic, and…
A: All these life cycles are based on the haploid and diploid phases. This is called alternation of…
Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…
A: Transcription Formation of RNA over DNA template is called transcription. Translation The process…
Q: cells are part of an organ in the digestive system. Use evidence to explain how the intestinal cells…
A: Human digestive system chiefly consist of gastrointestinal tract and associated glands.The process…
Q: How is viruses and protozoans can cause pathogenesis that is different from bacteria?
A: As we know that that the pathogen is disease causing organisms and can cause infection and…
Q: In a recent influenza epidemic, physicians were utilizing a rapid diagnostic test to determine which…
A: Influenza It is a viral infection caused by influenza virus. This virus infects the respiratory…
Q: Is this type of ETi sweets harmful? Wale "up wafer with COCoa cream
A: Is the sweets like water with cocoa cream harmful?
Q: Match the term in column A with its description in column B
A: The terms are correctly matched with the contents below
Q: SEQUENCING: Arrange thes systems of animals. Assign nur your notebook. 10. receptor potentia 11.…
A: Reflex arc Pathway along which nerve impulses travels during the reflex action.
Q: 1. Name the receptor indicated by the arrow labeled A. 2. What specific layer of the skin is…
A: 1. Meissner's corpuscle They contain a cutaneous nerve ending responsible for transmission of…
Q: 2. Next, use the Hardy-Weinberg equation (p + 2pg + g = 1) to calculate the expected frequencies of…
A:
Q: One objection many people have about vaccinations is the amount and variety of chemicals in them.…
A: Vaccination is a simple, safe and effective way of protecting you against harmful diseases. It uses…
Q: Indicate whether each of the following statements is true (T) or false (F). a. An unsubstantiated…
A: A virus is an infectious microbe consisting of a segment of nucleic acid (either DNA or RNA)…
Q: While you were driving to San Francisco, you saw many billboards on the highway but you could not…
A: The smallest level of stimulation that may be recognised is known as an absolute threshold, which is…
Q: Because bacteria are able to replicate at high rates, they aresubjected to mistakes or mutations…
A: Mutations in genes Single DNA base alterations, as well as minor intragenic deletions and…
Q: bacteria
A: Auxotrophic strains lack the ability to synthesize one essential compound for example amino acid.…
Q: A. The double-stranded DNA sequence for a bacteria is shown below and it's coding for a hypothetical…
A: Transcription is the process where mRNA will from form DNA, then mRNA will from protein in…
Q: 1. How do animals reproduce? 2. How do humans reproduce? 3. How can the use of hydroponics help…
A: Reproduction is the process by which organisms make more organisms like themselves. But even though…
Q: escribe how the plasmid is cut open by genetic engineers? 2. How is the insulin gene removed from…
A: Since you have ask multiple question, we will solve the first question for you. If you want any…
Q: 1. Female Drosophila with cinnabar eye (cn) and vestigial wings (vg) were mated to males with roof…
A: Test cross is a cross between F1 individual and recessive individual. By crossing the F1 individual…
Q: A series of two-point crosses were carried out among five loci (E, F, G, H, and I), producing the…
A: When two genes are near enough on the same chromosome, they are considered to be connected because…
Q: Stem cells can give rise to many different types of cells. How could stem cells most likely be used…
A: As stem cells are the cells which have the ability to divide and can give rise to many different…
Q: What triggered the development and establishment of mi-crobiology as a science?(a) Spontaneous…
A: Microbiology is a branch of science that studies microscopic organisms that are not visible to the…
Question in Image. Thank you!
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- Shown below are two homologous lengths of the alpha and betachains of human hemoglobin. Consult a genetic code dictionary and determine how many amino acid substitutionsmay have occurred as a result of a single nucleotidesubstitution. For any that cannot occur as a result of a singlechange, determine the minimal mutational distance. Alpha: ala val ala his val asp asp met proBeta: gly leu ala his leu asp asn leu lysBased on sequences A,B,C. Provide an anticodon sequence that would build this protein. Sequence ATCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGTSequence BTCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCAATCTCTTAATGACTSequence CTACAAACATGTAAACACACCCTCAGTGGACCAACTCCGCAACATAAACCAAACACCGCTCGCGCCGAAAAAGATATGGGive typing answer with explanation and conclusion The following gene codes for a liver enzyme. Changing the A/T base pair to which of the following would result in a missense mutation? 5’ GCCTAATATGCCCGTATGC(AGC)nCGAATAAAATAGTACGGTCGTCGC 3’ 3’ CGGATTATACGGGCATACG(TCG)nGCTTATTTT ATCATGCCAGCAGCG5’ A. C/G B. T/A C. G/C D. Any of the above E. 2 of the above F. None of the above
- give the amino acids specified by the following bacterial mRNA sequences. a. 5′ –AUGUUUAAAUUUAAAUUUUGA–3′ b. 5′ –AGGGAAAUCAGAUGUAUAUAUAUAUAUGA–3′ c. 5′ –UUUGGAUUGAGUGAAACGAUGGAUGAAAG AUUUCUCGCUUGA–3′ d. 5′ –GUACUAAGGAGGUUGUAUGGGUUAGGGG ACAUCAUUUUGA–3′A. What amino acid sequence is encoded by the codon sequence AUAAUGGUAACGGUU? B. Suppose the codon sequence AGACACUCUAUUAAA has a single base pair mutation to AGACACUCUUUUAAA. If the old protein sequence was Arg-His-Ser-Ile-Lys, what will be the new sequence encoded by the mutant gene?Suppose the codon sequence GCCAUUCAAGCGGAU has a single base pair mutation to GCCAUUCAAACgGAU. If the old protein sequence was Ala-Ile-Gln-Ala-Asp, what will be the new sequence encoded by the mutant gene? _________(Use the 3-letter amino acid abbreviations with hyphens and no spaces in between, i.e. Ser-Asn-Tyr-Le
- Identify the following mutations and describe what the possible effect on the protein will be. (4) 5’GAT TTT AGC TTA GCC CAT 3’ 5’ GAT TAG CTT AGC CCA T 3’ 3’CTA AAA TCG AAT CGG GTA 5’ 3’ CTA ATC GAA TCG GGT A 5’ 5’ GAT TTT AGC TTA CCC CAT 3’ 5’ GAT TTT AGC TAA CCC CAT 3’ 3’ CTA AAA TCG AAT GGG GTA 5’ 3’ CTA AAA TCG ATT GGG GTA 5’Shown is part of the coding strand of the HBB gene involved in sickle cell disease. What will be the effect on the resulting peptide of a deletion of the two nucleotides shown in bold/underline? 5' CTG ACT CCT GAG GAC 3' a) A change from glutamic acid to valine will occur b) The deletion will not result in a change to the polypeptide c) A nonsense mutation will occur d) The polypeptide will be missing one amino acid, but the reading frame will be preservedWhich of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
- PLEASE MAKE THE DR BRUJIN GRAPH From these k-mers construct a de Bruijn graph and determine the sequence of the contig. AGCG ATCT ATGA ATGG ATTC CCCT CCTG CTCT CTGA CTGC CTTT GAAG GATT GCGT GCTC GTTC TATG TCAT TCTA TCTT TGAA TGAT TGGA TGTT TTCA TTCC TTTCWhat RNA base sequence is complimentary to the following DNA base sequence 5'-CATGATTAT-3'? Using the table of codons, give the primary structure of the protein coded for by the RNA sequence: 5’-CCA CGA GGG GAG ACU UAA-3’?For the m-RNA nucleotide codons given below, what is the corresponding sequence of amino acids? AUG UGU AUA UAU GUA AUC ACC UUC UAU GUA ACA UUU UGG AAC AGC UGC CAU GUA UAC CAG AAA CUU GCA GAG CUG GCU UUG AUA UGA The α-helices are known to contain primarily the amino acids methionine, alanine, leucine, glutamate, and lysine, while β-pleated sheets are known to primarily contain the amino acids tryptophan, tyrosine, phenylalanine, isoleucine, valine, and threonine. Which one of these two types of secondary protein structure is present with this amino acid sequence?