Control of gene expression in eukaryotic cells occurs at which level(s)? Lütfen birini seçin: O a. epigenetic and transcriptional levels O b. post-transcriptional, translational, and post-translational levels O c. only the transcriptional level O d. epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels O e. epigenetic, transcriptional, and translational levels

Control of gene expression in eukaryotic cells occurs at which level(s)? Lütfen birini seçin: O a. epigenetic and transcriptional levels O b. post-transcriptional, translational, and post-translational levels O c. only the transcriptional level O d. epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels O e. epigenetic, transcriptional, and translational levels

Concepts of Biology

1st Edition

ISBN:9781938168116

Author:Samantha Fowler, Rebecca Roush, James Wise

Publisher:Samantha Fowler, Rebecca Roush, James Wise

Chapter9: Molecular Biology

Section: Chapter Questions

Problem 10RQ: Control of gene expression in eukaryotic cells occurs at which level(s)? a. only the transcriptional...

See similar textbooks

Similar questions

Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repair
Based on my your observations, describe the role of the transcription factors and the regulatory region of a gene in gene expression
How is transcription directly controlled in eukaryotic cells? a. through the use of phosphorylation b. by means of apoptosis c. using transcription factors and activators d. when chromatin is packed to keep genes turned on e. None of these are correct.
Translational control of gene expression occurs within thea. nucleus.b. cytoplasm.c. nucleolus.d. mitochondria.
Q. Cro protein expression and activity may be activated in a prophage by a)lysogenic dominance b)rapid growth of a healthy cell c)repair of damaged cellular DNA d)presence of glucose in the environment alternate exon splicing of mRNA
Give two examples of how DNA bases and chromatincan be modified to regulate gene expression, and explainwhy these kinds of modifications result in increased ordecreased gene expression.
You have isolated a protein that binds to DNA in theregion upstream of the promoter sequence of the sysgene. If this protein is a positive regulator, which ofthe following would be true?a. Loss-of-function mutations in the gene encodingthe DNA-binding protein would cause constitutiveexpression of sys.b. Loss-of-function mutations in the gene encodingthe DNA-binding protein would result in little orno expression of sys.
A) List the steps for gene expression in prokaryotes and eukaryotes. B) Relate the differences in gene expression between prokaryotes and eukaryotes in gene expression regulation and explain what causes those differences.
Suppose that you have cancer cell line X was treated with drug Y toincrease the expression levels of protein Z which is a tumorsuppressor gene. (no need for this qustion)Explain How can you study protein Z in these cells? (needed)
Gene expression does not vary by_______ . a. cell type c. stage of development b. extracellular conditions d. the genetic code
Which statement/s is/are TRUE about transcription?A. During transcription, DNA polymerase binds to RNA and separates the DNA strands.B. RNA polymerase uses one strand of DNA as a template to assemble nucleotides into a strand of RNA.C. RNA polymerase binds only to DNA promoters, which have specific base sequences.D. Promoters are signals in RNA that indicate to RNA polymerase where to begin transcription.E. Transcription occurs in the 3’ to 5’ direction with respect to the growing mRNA strand.
a) Define the term gene expression b) State 4 difference between prokaryotes and eukaryotes gene expression c) state the importance of regulating gene expression