Explain How can you study protein Z in these cells? (needed)
Q: Suppose a gain-of-function mutation happens in an oncogene. Which of the following changes is likely…
A: Cancer causing gene is known as oncogenes and its an abnormal active gene which promotes growth of…
Q: Phorbol esters have been observed to induce the transcription of AP-1–influenced genes. Explain how…
A: Signal transduction is a process in which signals from the extracellular level enter the…
Q: Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…
A: Translation is the process which is responsible for synthesis of protein from the mRNA.
Q: You have isolated a protein that binds to DNA in theregion upstream of the promoter sequence of the…
A: Positive regulation refers to the increased transcription of a gene by binding of a protein or a…
Q: How does an intracellular receptor regulate gene expression in the cell? Describe briefly what…
A: Intracellular receptors found inside the cell. Typically in the nucleus and cytoplasm. They are…
Q: Cancers are often caused by overactive growth factor receptor signaling (remember growth factor…
A: Cancer is a disease which is caused by the uncontrolled growth of the cells, without regulation of…
Q: Understanding why these receptors are present when they are not supposed to be is important in…
A: When there is methylation at the cytosines present in promoter the genes are silenced as they blocks…
Q: Some protein kinases are inactive unless they are phosphorylated on key serine or threonine…
A: There are two type of protein kinase: serine/threonine kinase and tyrosine kinase. The serine/…
Q: A mutation occurred on the lacI (repressor) gene resulting in a constant production of…
A: Genes are the functional segments of DNA. The cluster of these functional segments called genes is…
Q: A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho…
A: Transcription is the process of transcribing DNA into mRNA with the help of RNA polymerase. Rho…
Q: Ignoring transcriptional methods, name two other "levels" aka methods a cell can use to ultimately…
A: The process of regulating which genes in a cell's DNA are expressed (used to create a functional…
Q: Harry Potter speaks parseltongue(he can talk to snakes). Dumbledore explains that this is because…
A: Language is an example of a trait that is learned and developed throughout a lifetime. Language is a…
Q: Cancer cells removed from a patient's tumor have increased gene expression of several hundred genes…
A: Cancer Cancer if a kind of disorder which caused by several means like drug, radiation, malfunction…
Q: functional insulin required the association of two polypeptides known as the A and B chains…
A: Pre transcription control involves in DNA methylation. Transcriptional control involves in…
Q: Expression of ---- does not require new protein synthesis. a.immediate early genes b. delayed…
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: Select the answer that correctly expresses a valid comparison between transcriptional regulation in…
A: Transcriptional regulation is far more complex in eukaryotes than in prokaryotes. Prokaryotic…
Q: You are teaching a class on the regulation of eukaryotic gene expression. In order to demonstrate…
A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…
Q: Please explain the role of gene expression in the process of a stem cell differentiating into a…
A: Gene expression is the process of central dogma where protein is formed from DNA. Stem cells have…
Q: Suppose that you have cancer cell line X was treated with drug Y to increase the expression levels…
A: The genes that suppress tumors are ordinary genes, which delay cell division, fix DNA errors or tell…
Q: The functioning of enhancers is an example of(A) a eukaryotic equivalent of prokaryotic promoter…
A: Enhancer refers to a short region of DNA. It increases the process of transcription of a particular…
Q: Explain how can you study protein Z components? (needed)
A: The proteins are the macromolecules and these structures are so so small that they can be seen by a…
Q: Please explain correct answer
A: Apoptosis is an energy dependent genetically programmed process which occurs during embryogenesis,…
Q: Suppose the DNA sequence of a gene with 5 exons contains a mutation at the 5’ end of intron 2.…
A: The protein translation is the process of the formation of proteins from the mRNA formed from the…
Q: Assume a bacterial cell has a mutation in the gene that codes for CRP, such that the mutant CRP-CAMP…
A: An operon is a set of structural genes regulated by a common promoter in bacteria.
Q: Based on the labels you should be able to recognize the characteristic structure depicted below and…
A: Introduction The Process Of Turning Nucleic Acid Information Into Amino Acids Is Known As…
Q: Suppose that you have cancer cell line X was treated with drug Y to increase the expression levels…
A: Cancer cell lines are usually generated by isolating them from the cancer tissue itself. These cells…
Q: In the case of the insulin receptor (IR), the RNA-binding protein RBP described in lecture in muscle…
A: RNA binding proteins bids to mRNA based on structure or sequence and form ribonucleoprotein…
Q: How would you identify patients whose tumor cells are particularly likely to have a somatic mutation…
A: Somatic mutation takes place in all types of cells in the body except the germ cells. Therefore…
Q: CTP synthetase is allosterically activated by GTP. What function might this play in the cell?
A: CTP synthetase is an enzyme which converts UTP ( Uridine Triphosphate) to CTP ( Cytidine…
Q: Rare gain-of-function mutations cause increased _______________production, synthesis of an altered…
A: Mutation is the change in an organism’s DNA sequence. The change may occur in the sequence of bases…
Q: Cytopathic effects (CPE) are visible changes in cells due to: A)viral infection B)mutations…
A: Cytopathic effects are structural changes in a cell which can be easily viewed under a compound…
Q: TGF-β1 is a protein that affects cell growth and differentiation. Scientists conducted an experiment…
A: Gene expression is the production of RNA (mRNA ) from the DNA by the process of transcription. By…
Q: Under normal physiological conditions, proto-oncogenes and tumor suppressors help control cell…
A: A significant contrast among the oncogenes and tumor suppressor genes is that oncogenes result from…
Q: You study the expression of the hexose kinase gene and capture the following electron micrograph of…
A: Translation is the formation of protein from the mRNA in the cytoplasm.
Q: Wilms tumor 1, or nephroblastoma, is caused by mutations in the WT1 gene, which encodes a…
A: Molecular biology is an emerging field which focuses on the molecular basis of all biological…
Q: Many genes whose expression is turned on by DNAdamage have been isolated. Loss-of-function mutations…
A: The lex A gene encodes a repressor protein and is involved in controlling the DNA repair, inhibition…
Q: New drugs are being developed that decrease DNA methylation and prevent the removal of acetyl groups…
A: Introduction Chromatin fibre can be classified into two types based on the condensation:…
Q: You know that the mRNA and protein produced by aparticular gene are present in brain, liver, and…
A: The mRNA (messenger Ribonucleic acid) and protein are present in all the three cell types; that is…
Q: Blocking the ability of DNA methyltransferases to target the glucocorticoid receptor gene would…
A: DNA methyltransferases These are a conserved family of cytosine methylases that are involved in…
Q: Protein levels and mRNA levels for a particualr gene don’t always match. For example, the GCN4 gene…
A: Sometimes, the levels of protein and mRNA of a particular gene will not match. The mechanism behind…
Q: Gene expression can be affected by all of these EXCEPT: - Considering chromosomes -Adding mote…
A: Gene expression is the process by which information from a gene is used in the synthesis of a…
Q: e. You also study the expression of a different mutants for this gene. For each mutant answer the…
A: Translation is the process of synthesis of protein from the mRNA in the cytoplasm of cell.
Q: 2. Transaription of gene X is controlled by transcription factor A (TFA). Gene X is only transcribed…
A: Protein kinases are enzymes that add phosphates to a particular substrate/protein/enzyme etc. While…
Q: how would the disruption of the Rb family of proteins lead to cancer? Describe the possible…
A: Please follow step 2 for detailed explanation.
Q: Cystic fibrosis is genetic disease caused by mutations in the CFTR gene. The consequence of this is…
A:
Q: You wish to find the cis-acting regulatory DNA elements responsible for the transcriptional…
A: One or more trans-acting factors frequently bind to cis-regulatory components. To conclude,…
Q: The human insulin gene contains a number of sequences that are removed in the processing of the mRNA…
A: Insulin is a hormone released by beta cells of the islets of Langerhans of the pancreas. This…
Suppose that you have cancer cell line X was treated with drug Y to
increase the expression levels of protein Z which is a tumor
suppressor gene. (no need for this qustion)
Explain How can you study protein Z in these cells? (needed)
Step by step
Solved in 2 steps
- Which statements decribe the function of the protein encoded by this gene CAGATTGTGAAGAGGTCTCTTGA? A. Break point cluster region protein that may function as a GTPase B. A coagulation factor C. An enzyme involved in the breakdown of glycosaminoglycans (GAGs) D. Transcription factor involved in the DNA damage response E. A component of hemoglobin F. A tyrosine kinase G. Serine/threonine kinase involved in the DNA damage response H. A tumor suppressor involved in WNT signalling I. A DNA repair enzyme involved in nucleotide excision repairGene expression can be affected by all of these EXCEPT: - Considering chromosomes -Adding mote ATP -Degrading mRNA -Degrading proteinsBoth ADA-SCID and type I diabetes are diseases based on lack of a particular protein. Why has the pioneering work on gene therapy focused on SCID instead of on diabetes?
- Your collaborator from Fisk University has isolated proteins from healthy prostate cancer cells. You want to compare and contrast the two protein expressions from part 4. Write up the procedure to examine protein expression from the prostate cancer cells and healthy prostate cancer cells.Suppose that in the formation of phenylalanine hydroxylase mRNA, the exons of the pre-mRNA fail to splice together properly and the resulting enzyme is nonfunctional. This produces an accumulation of high levels of phenylalanine and other compounds, which causes neurological damage. What phenotype would be produced in the affected individual?The tumor suppressor pRB also binds to and suppresses theactivity of retinoblastoma binding protein 2 (RBP2), ahistone demethylase that removes methyl groups from diand trimethylated lysines in histone 3. What is the possibleconsequence of an inactivating mutation in RB1 that causesan inability of pRB to bind RBP2?
- Imagine you are a cell and you need to activate ("turn on") a gene as quickly as possible. What type of gene expression regulation would you use to achieve this?a hormone receptor gene is deleted from the genome of a cell.in the absence of the hormone,what would you except about the expression of a gene that is activated by the hormone signiling?what would you expect to happen to the gene expression if the same cell is now treated with hormone?List and discuss four different mechanisms by which vitamins A and D regulate gene expression.
- Cancer cells removed from a patient's tumor have increased gene expression of several hundred genes (including many cancer-causing genes). Scientists determine that the histones from the cancer cells have an overall/average lower affinity for DNA than histones from normal control cells. Which drug is most likely to help treat this patient's cancer? a. An inhibitor for HMT (histone methyltransferases) b. An inhibitor for HDM (histone demethylases) c. An inhibitor for HDACs (histone deacetylases) d. An inhibitor for HATs (histone acetyltransferase)Cancer is caused by many different types of gene mutations. Some mutations are in proto-oncogenes, which lead to overexpression of the genes, and other mutations are in tumor suppressor genes, which lead to under expression or no expression in these genes. Which kinds of gene mutations would RNA interference (RNAi) be better at treating? Explain.Imatinib is an anti-cancer drug that inhibits the function of CD117, a receptor protein coded for by the KIT gene. Mutations in the KIT gene are implicated in gastrointestinal cancers. Aimee, who has a gastrointestinal tumor asked her doctor if she could try Imatinib, but her doctor first required that she get a biopsy of her tumor. Hair loss is a well-known side effect of chemotherapy; why does this side effect occur? (1) Chemotherapy targets cells undergoing division. Hair stem cells are constantly replenishing (growing) just like cancer cells. They are then also targeted by chemotherapy, causing hair loss. (2) Chemotherapy targets all cells, whether dividing or not dividing, and hair cells are collateral in the fight against cancer (3) Chemotherapy targets proteins in our cells and hair cells have an abundance of proteins