Q: i am confused on which question you answer
A: 26. Cognitive health for a 80 years old patient should include: Cognitive health is just one feature…
Q: What type of talk typically has to decrease before a client will start to express more change talk?
A: Change talk and maintain talk both exhibits a person's reluctance toward change on opposite ends of…
Q: How do commensalism affect each other
A: Any relationship or interaction between two dissimilar organisms is known as symbiosis. The specific…
Q: Rubbing lavender essential oil on the _______ has been shown to relieve depression, anxiety and…
A: Lavender is a herb popular for its attractive flower of purple color with flower aroma. It has been…
Q: What did Maurice Wilkins’ work before working with Rosalind Franklin? What event changed Maurice…
A: Wilkins studied biological molecules like DNA and viruses using a variety of microscopes and…
Q: You must Answer no.6 to no. 9. Multiple Choice only. No need to explain each answer. Provide a…
A: All life on earth began from the universal last common ancestor which lived 3 to 4 billion years…
Q: Please answer these question with full explanation and labal the answers so i know which answer goes…
A: Osmosis is the process by which solvent molecules move from a region of higher concentration to a…
Q: .Choose the correct sentence Does you have much sugar? We used noun phrase in the place of noun to…
A: Figure of speech It refers to the deviation from standard usage of words in order to improve their…
Q: Would you be able to assist with questions 3 and 4? (I know that will count as two questions)
A: Mutations in the DNA happen at random and are not directed in any way to bring about a positive or…
Q: Three legal obligation of students according to PHIPA
A: Health Information Protection Act 2004 has 2 components, one of which is PHIPA(Personal Health…
Q: Observations and inferences are
A: In descriptive research, observation is defined as the primary source of data collecting. In the…
Q: Which one is right and wrong and what might be the correct answer
A: The control and coordination of the body in humans are done by two systems: the nervous system and…
Q: psychologist help the person with the condition
A: The syndrome is a normal effect that occurs in the body. a syndrome is the onset of a disease that…
Q: Clinical psychology
A: Psychology has many branches that are as follows:1)Abnormal psychology 2)Behavioural psychology…
Q: e show your work how you got the answer
A: Physician order alpazolam=0.5mg PO PO means medicines taken by mouth twice a day 0.5mg means…
Q: Question 74 Which of the following is an important nursing responsibility related to pain?…
A: A nurse is a qualified professional who plays a critical role in the health care by providing…
Q: Multiple Choice and Essay
A: Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…
Q: When a person fears another enough to act or behave differently than he would otherwise, the source…
A: In 1959,French and Raven described power under the following heading Coercive Power Reward power…
Q: 1. Explain the role of Statistics in biological science.
A: Statistics is the science of collecting, analyzing, presenting, and interpreting data.
Q: Choose the one most appropriate answer for each.
A: Chemical reactions that take place in the biological systems are defined as metabolism. Metabolism…
Q: Do sentences a and b have different meanings? If so, how are they different? 1 a If I'm too tired, I…
A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…
Q: During rest, an adul
A: The heart rate is the number of times the heart beats in a minute. The heart pump blood with oxygen…
Q: Is the answer?False or true
A: Fetus An unborn baby at early stages are called an embryo. The one which develops from an embryo…
Q: What is the best option?
A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…
Q: Choose the correct response based on the figure:
A: The figure is showing a weighing balance.
Q: number 2, 3 and 4. If you cant answer all the numbers then it's okay.
A: Q.2 Difference between cat and dog : Carnivorousness : Dogs are scavenging carnivores meaning dogs…
Q: Can some please answer this
A: The Green plants prepare their own food from carbon dioxide and water in presence of sunlight is…
Q: Figure C
A: Heart is the main organs of the circulatory system. Human heart is more complex and advanced as…
Q: When you get a “stuffy nose” due to an allergy, cold or sinusitis, your food becomes tasteless.…
A: Taste and smell are the perception of chemicals in the air or in our food. Taste and smell are…
Q: please give answer in simple language and draw diagram where necessary
A: The stereochemistry of phospho acyl glycerol is such that they have a hydrophobic end as well as a…
Q: What hobbie/s can you engage in, describe it, where and when can you do it?
A: Hobbies may play an important role in modern days to take a break from the stress of daily life .
Q: Just match tha following with minimum explanation Do not insert any image type your answer and…
A: Consistency of association- B. Ethics and feasibility often limit application of this criterion in…
Q: Why having a good attitude important for meditation . Give an explanation and example
A: Alternative medicine It is different from traditional medicine. Traditional medicine focuses on…
Q: * .Choose the correct sentence Does you have much sugar? We used noun phrase in the place of noun to…
A: Answer : the sentences given are not correct. The correct sentences are : 1) Wrong sentence :…
Q: Answer all the question. Just choose the letters.
A: Note: Since you have asked for multiple subparts, we will solve the first three for you. If you want…
Q: why it is important for pharmacy to have a door that automatically opens as someone approaches it…
A: Automatic doors can help individuals save energy and resources by lowering the yearly heating and…
Q: Which is better teaching in hospital settings or school setting?
A: Teaching is a profession which help the students and ones who seek knowledge Different methods of…
Q: i submitted this question twice and i got different answers
A: Enzymes are biocatalysts which increase the rate of biochemical reactions. And the activity of…
Q: What is the art of persuasion? rhetoric pathos ethos logos
A: The answer is Rhetoric
Q: Your body can be stressed by ............ . Fill in the blank with the right answer. a. cold…
A: Stress is the condition of physical or emotional tension in the body. It can be caused by various…
Q: Which question can the students answer using the information in the Punnett square
A: genetics is the study of gene , their segregation , linkage , traits and all aspects of chromosomal…
Q: The _______________ area is distal to the _____________ area. Group of answer choices carpal,…
A: The knowledge about anatomical positioning to study the human anatomy is very much important.…
Q: What random act of kindness toward strangers would you do? Do you think you will carry out the act…
A: Random acts of kindness can lift up anyone’s spirits, and you hold the power to make someone’s day…
Q: Make a 3-sentenced paragraph on how the nervous system helped in maintaining homeostasis (balance)…
A: The nervous system comprises the brain, neurons and spinal cord. The nerves are responsible for…
Q: I need the answers for others questions
A: Please Note: As multiple questions have been asked, We would be able to answer question number…
Q: What is Reciprocation when it comes to influencing someone to do something
A: There are 6 principles that were introduced by Robert Cialdini and one among them is the reciprocity…
Q: What is the best choice ?
A: Penicillin is popularly used antibiotic to treat staphylococci and Streptococci bacterial…
Q: which statements are False
A: Glucose is the ultimate source of energy for humans which is metabolized and converted into pyruvate…
Step by step
Solved in 2 steps with 1 images
- 1. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends. Follow the same format as the given sequence. 2. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. Assumption is that the first amino acid is the N-terminal. 3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids in the peptide? Use the 3-letter code of the amino acids. Separate the amino acids with a dash (-). NO NEED to indicate the N- and C-terminal amino acids. The assumption is that the first amino acid is the N-terminal.Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
- 1. What is the nucleotide sequence of the complementary strand of the DNA molecule: 5’-AATGCGATCTTCAT-3’?2. What is the nucleotide sequence of the mRNA transcribed from the template DNA strand: 3’-GCTACAAAAAGTCCATAATCGC-5’? Indicate the 5’ and 3’ ends.3. If the mRNA sequence you obtained in question 2 were to be translated, what would be the sequence of amino acids? Indicate the N-terminal and C-terminal amino acids.2a) Suppose you have a gene in which a single base substitution has created the nonsense mutation 5'TAA3' (which will be transcribed into 5'UAA3' in the mRNA - but recall that mutations are changes in the DNA sequence). Name all the amino acids that could have been coded for by the original, unmutated codon at that position in the gene.1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
- The following is a portion of an mRNA sequence: 3’ –AUCGUCAUGCAGA-5’ a)During transcription, was the adenine at the left-hand side of the sequence the first or the last nucleotide used to build the portion of the mRNA shown? Explain how you know. b)Write out the sequence and polarity of the DNA duplex that encodes this mRNA segment. Label the template and coding DNA strands. c)Identify the direction in which the promoter region for this gene will be located.1. A region of DNA in a particular cell synthesizes a segment of RNA that is 174 bases long and in the form of a large palindrome. The RNA is transported to the cytoplasm and folds into a hairpin loop of double stranded RNA. In the cytoplasm, the hairpin loop is recognized by a double-stranded RNA cutting enzyme (dicer) and is cut into 21 BP lengths. When these 21 BP double stranded segments are combined with protein, they function by: Answer choices destroying specific mRNAs priming the synthesis of DNA sequences adding DNA to the chromosome ends (telomeres) acting as decoys for RNA degrading enzymes thus protecting the mRNAs present splicing the introns out of messenger RNA 2. The following are genotypes of merozygotes of E. coli with various combinations of lac operon mutations. Determine the phenotype with respect to beta-galactosidase (z), permease (y), and trans-acetylase (a) of each combination as U = uninducible, I = inducible, and C = constitutive. Choose from…4) Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Indicate all the possible mRNAs that could be produced from this gene (you don't need to draw new schematics - just list the regions that would be included in each mRNA by number)
- The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?Shown below is a double-stranded bacterial (E. coli) DNA sequence coding for a hypothetical protein. The nucleotides are numbered 1 to 100. a)Although the transcription start site begins at the underlined C/G, which of the following is the nucleotide sequences needed upstream for transcription to actually occur? b)What are the first 15 nucleotides of the mRNA? c)What are the first 5 amino acids translated from the resulting mRNA? d)A different mutation results in the substitution of the T/A base pair at position 30 (shown in bold and underlined) with a G/C base pair. How would this mutation affect the sequence of the protein that is produced?The following represents a transcription unit in a hypothetical DNA molecule in E.coli. (Transcription can use either strand, but by convention we always put 5’à 3’ on the top.) 5’…..TTGACANNNNTATAAT…3’ 3’…..AACTGTNNNNATATTA…5’ If this molecule is transcribed from left to right, then the ____ strand will be the template strand and the ___ strand will be the non-template strand. top, bottom bottom, top