Question

Create a Schematic Diagram from the Procedure:

PROCEDURE:

I. Isolation of Milk Component

A. Casein

  1. Pour 75ml of milk into a beaker and slowly add 35ml 10% lactic acid. Stir constantly until the Formation of casein precipitates.
  2. Filter and save the filtrate (filtrate 1) for procedure B & C.
  3. Collect the precipitate and place it into a beaker, add 25ml acetone.
  4. Stir well and filter the acetone. Catch the filtrate (filtrate2 for procedure D) in an evaporating dish.
  5. Transfer the casein to a filter paper and allow it to dry.
  6. Test the casein to prove that it is a protein (Proceed A.1Confirmatory Test for Casein Procedure)

A.1 Confirmatory Test for Casein

    1. Suspend the casein in 15ml distilled water
    2. Stir well and filter
    3. Perform Biuret, Millon’s, and Hopkins-Cole tests on the filtrate. (Refer Activity 9)
    4. Record Observation

B. Lactose

  1. From the filtrate (filtrate1) in procedure A, get 2ml sample.
  2. Perform Benedict’s Test.

C. Globulin

  1. To 5ml of the filtrate from procedure A, add 10 drops of phenolphthalein indicator, and then add milk of lime or a suspension of Ca(OH)2 until a faint pink color appears.
  2. Filter and make the filtrate neutral to litmus paper by adding 1% HCl solution.
  3. To this solution, add an equal volume of 10ml saturated (NH4)2SO4 solution
  4. Filter and note the results.

D. Fat

  1. Evaporate the acetone solution from procedure A.4 (filtrate2) in the evaporating dish to dryness on a steam bath. (Keep the evaporating dish away from the flame
  2. Observe the residue.

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biochemistry

Biomolecules

Related Biochemistry Q&A

Find answers to questions asked by students like you.

Q: 5. What will happen to  a protein if subjected to high tempuraturea?

A: All proteins are affected by temperature and acidic or basic environment. The activity of a protein ...

Q: A solid forms in the calcium hydroxide trap during the fermentation. What is the solid? Write a bala...

A: Calcium hydroxide is also known as lime water. It is colorless or white powder produced by the react...

Q: What happened to the protein absorption capacity of an individual as they age? What specific interve...

A: Protein is a macronutrient. It is used for forming muscle mass. It commonly occurs in animal product...

Q: A water sample from which 10, 1, and 0.1 ml/100mL dilutions resulted in 5, 4 and 3 positive lactose-...

A: Most probable number (MPN) is a method for estimation of the concentration of viable micro-organisms...

Q: An increase in glucagon levels can a. Promote the degradation of glycogen (i.e., glycogenolysis) b. ...

A: Glucagon can be defined as a peptide hormone. It is produced by the alpha cells of the pancreas. It ...

Q: 12. Nirogenase is an enzyme that converts the remarkably stable triple bond in N2 into a usable form...

A: Nitrogenase is the enzyme that catalysis the conversion of nitrogen to ammonia. This enzyme plays a ...

Q: Which of the following fatty acids, if incorporated into a typical eukaryotic membrane phospholipid,...

A:    Biological lipids are a chemically diverse group of organic compounds which are insoluble or poor...

Q: Explain how NADH carry electrons by explaining what a hydride is.

A: A hydride is traditionally the hydrogen anion, H-. The term is liberally interpreted. All materials ...

Q: Compare Lock&key and Induced fit mechanism of enzyme action.

A: Enzymes are biological catalysts. They are mostly proteinaceous in nature and function to alter the ...

Q: Describe the mechanisms that limit signaling by the phosphoinositide pathway.

A: Proteins with lipid recognition, kinase, phosphatase, and phospholipase activities are dynamically m...

Q: 1. Explain how each primary structure of a protein affects its properties and how denaturation chang...

A: Proteins are the polymers of nitrogenous monomeric units called amino acids.  Structure of a protein...

Q: Why is the double-helical structure of DNA stabilized at moderate to high ionic strength?

A: Ionic strength defines the high concentration of ions in the solution that are produced due to the d...

Q: Does entropy increase or decrease in the following process?

A: Phosphoglycerate mutase catalyzes and converts 3-phosphoglycerate to 2-phosphoglycerate. This enzyme...

Q: Triacylglycerols in adipose tissue do not enter the bloodstream as triacyglycerolsexplain

A: Triacylglycerols, also known as triglycerides, are a type of fat (lipid) found in your blood. A trig...

Q: For an enzymatic reaction, draw curves that show the appropriate relationships between the variables...

A: An enzymatic reaction is a reaction that involves conversion of substrate molecule into product by h...

Q: Explain where you are most likely to find allosteric enzymes in metabolicpathways

A: Metabolism is defined as the sum total of all the chemical reactions taking place in a cell to syn...

Q: True or false?

A: Introduction: An enzyme inhibitor is defined as a substance that binds with the enzyme and brings ab...

Q: Consider a protein in which a negatively charged glutamic acid side chain (pKa = 4.2) makes a salt b...

A: Amino acid is organic compound which contains a carboxyl group, an amino group, and a variable side ...

Q: What is the approximate net charge of carnosine at pH 7.

A: Carnosine is a dipeptide, and is also known as beta-alanyl-L-histidine. It is made up of beta-alanin...

Q: Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC   Provide the FULL protein sequence encoded by the gene. Ar...

A: A gene is the basic structural and functional unit of heredity. They are made up of DNA. 

Q: Write a balanced equation for the complete oxidation of each of the following, and calculate the res...

A: The respiratory quotient (RQ) is a dimensionless number used inn the calculations of basal metabolic...

Q: Understanding biostatistical principles is critical to public health education.  True  False

A: Biostatistics is defined as the subject involving the application of statistical principles in the f...

Q: Enzyme A catalyzes the reaction S → P and has a KM of 50 μM and a Vmax of 100 nM ∙ s−1. Enzyme B cat...

A: Enzyme is a biological catalyst and is almost always a protein. It speeds up the rate of specific ch...

Q: A segment of DNA containing 20 base pairs includes 7 guanine residues. How many adenine residues are...

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each othe...

Q: 9.5: The reaction below is an early step in the synthesis of tyvelose, a sugar found on the surface ...

A: Initially, glucose-1 (G1P) phosphate is converted into CDP-glucose to CDP tyvelose. The CDP-tyvelose...

Q: The decomposition of crystalline N2O5                                                              N...

A: In thermodynamics, the Gibbs free energy change is a thermodynamic potential that can be used to cal...

Q: The precise mechanism of ammonia toxicity to the brain is not known. Speculate on a possible mechani...

A: Ammonium toxicity is known to cause the condition of hyperammonemia, which is considered a very dang...

Q: Give the name for this molecule: CH3. CHCH,-C-O-H CH3 II

A: Propyl acetate is an organic compound used as a solvent in coatings and printing inks. This product ...

Q: 4. What are three enzymes present in saliva and  function of any one of the enzyme?

A: The physical and biochemical of the breakdown of food particles into small absorbable fragments is k...

Q: Assume a pH gradient of 4.0 units across a thylakoid membrane, with the lumen more acidic than the s...

A: The thylakoid membrane of chloroplast is the site where the light reaction of photosynthesis takes p...

Q: Design a chloromethylketone inhibitor of elastase.

A: Chloromethylketone is a protease inhibitor. Its structural formula is 1-chloro-3-tosylamido-4-phenyl...

Q: The protein insulin consists of two polypeptides termed the A and B chains. Insulins from different ...

A: A protein's isoelectric or isoionic point is the pH where no net electrical charge is held by a prot...

Q: For an enzyme-catalyzed reaction, the presence of 5 nM of a reversible inhibitor yields a Vmax value...

A: An enzyme is a biological catalyst and is almost always a protein. It speeds up the rate of specific...

Q: The role of low-density lipoprotein in chronic heart disease and familial hypercholesteremia

A: Lipoproteins are composed of phospholipids, which form a hydrophobic core. It also comprised of chol...

Q: Activity: Label A through H Cytosol Mitochondrion-

A: cellular respiration and its various steps.