Answered: d out the plant pathogens have had a…

d out the plant pathogens have had a large impact on civilization over the years? 1.Claviceps purpurea 2.Saccharomyces 3.Phytophthor

BIOLOGY:CONCEPTS+APPL.(LOOSELEAF)

10th Edition

ISBN:9781305967359

Author:STARR

Publisher:STARR

Chapter20: The Protists

Section: Chapter Questions

Problem 9SA

See similar textbooks

Related questions

Q: How similarity between gene sequences can be used to infer function ?

A: Gene is considered a basic unit of heredity. It contains the codes in the form of nucleotides for…

Q: What is the difference between a knockout animal and a transgenicanimal?

A: Knockout and transgenic animals are used in genetic engineering and Biotechnology experiments either…

Q: Which of the following is not a characteristic of X-linked recessive traits in humans? a.…

A: X linked recessive is a condition caused due to recessive mutant genes located in X chromosomes. In…

Q: All the non-shaded individuals are wild type apart from III.1. III.1 has been proven to have the…

A: The penetrance of a population is the proportion of individuals who share a particular trait and…

Q: Explain the fundamental challenges of genomics ?

A: Genomics is the branch of biotechnology that deals with the structure, function, evolution and…

Q: Indentify how the factors of biotic potential and environmental resistance as well as predation and…

A: Biotic potential can be defined as the increase in the population in an ideal environment without…

Q: 1. Under each sequence of bases, write the sequence of bases complementary to each section of DNA in…

A: Introduction : The primary nucleobases are cytosine (DNA and RNA), guanine (DNA and RNA), adenine…

Q: [ Discuss and react. ] Maximum of 4 sentences. Give science-based arguments. Bt corn directly…

A: Bt Corn (Bacillus thuringiensis) is a genetically modified crop, which is produced by introducing…

Q: Contrast ST and NST in humans and non-human animals. Why does Marchand (or any other evidence)…

A: The process through which organisms produce heat is known as thermogenesis. It is found in all…

Q: 9. Fishkeepers are interested in putting some species of bacteria in their water tanks because of…

A: Ans - c) Nitrification The use of microbes to reduce nitrogen compounds, especially Ammonia the…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences…

A: Given DNA strand: 5' - CCTATGCAGTGGCCATATTCCAAAGCATAGC - 3'

Q: A botanist two diferen took trans Specimens s microscope Leat from Plant 1 с CC . P The plants а…

A: Stomata are the cell structures which are pore like found in the epidermis of leaves, stems etc.They…

Q: Come up with two of your own questions (original questions) related to the topic of Huntington's…

A: Genetic disorders are caused by genes.

Q: Which are four general types of tissues?

A: Introduction: A tissue is made up of a group of cells that perform comparable tasks and cause…

Q: If the mRNA molecule from your answer to the previous question is going to be translated into a…

A: The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

Q: Complete Table 1, indicating how much (lots, little, none) of the above gene product would be made…

A: Transcription It is defined as the process of transcribing the segment of the DNA to the RNA, which…

Q: What is binary fission? How is this different than cell division in Eukaryotes?

A: Reproduction is a phenomenon takes place inside the living organisms during which one organism gives…

Q: Which are Body Fluid Compartments?

A: Human body weight is mostly composed of water, which ranges from around 75 percent in babies to…

Q: Which of the following about basophils and mast cells is true? 1) basophils make leukotrienes, and…

A: Introduction: a particular sort of blood cell that is produced in the bone marrow and present in…

Q: In a sequence encompassing 99.4 percent of theeuchromatic regions of human chromosome 1, Gregoryet…

A: A genome is an individual's whole supply of deoxyribonucleic acid (DNA), a substance which holds the…

Q: Compare and contrast sexual reproduction vs. asexual reproduction.

A: Answer :-

Q: Explain the glycolysis: Where happens How it happens Substrate - products What is used, what is…

A: Introduction Cellular respiration is a process in by which complex sugar molecules are metabolised…

Q: lactose b. Repression CAP lac I repressor allolactose CAMP с RNA Pol promoter operator +1 lac Z lac…

A: Lactose operon or lac operon defines a set of certain genes that regulates the breakdown, uptake and…

Q: On the basis of respiratory losses, arrange the producers (A), herbivores (B), top carnivores (C)…

A: The food chain's producers contain 100% of the world's energy and biomass. Energy and biomass are…

Q: 23. Design the forward, reverse, and internal primers to the gene below and mutate the…

A: Primers are stretches of nucleic acids (either DNA or RNA) that help in DNA replication. DNA…

Q: Which of the following is most expected with polycythemia? a) Decreased blood viscosity b) Decreased…

A: Blood cancer of this kind is called polycythemia vera. The bone marrow produces an excess of red…

Q: What axis is shared by (1) transverse plane and sagittal plane, (2) transverse plane and…

A: Human have bilateral symmetry and there are three main axis of bilateral anatomy.

Q: can help me help to understand this slides by labelling them and describe them

A: Areolar connective tissue is the kind of tissue that covers and links the body's many organs. The…

Q: zoologist is working on study a deer and find that a gene is located on autosome two. The found…

A: In terms of genetics, inheritance is the process through which an organism transfers features from…

Q: TM Ps. au OX AMC S E CC SXT ΤΕ .25.07 CIP C CF P

A: The effectiveness of an antibacterial treatment on a surface or product can be quickly assessed…

Q: Question 9 o Which of these is true about the pO2 at the end of the pulmonary capillaries in…

A: Pulmonary capillaries are the smallest blood vessels inside the lungs. It carries deoxygenated blood…

Q: Which hormone is produce in the male reproductive system?

A: The male gametes in humans are known as sperms, and the process through which they develop is known…

Q: Evolution determines the change in inherited traits over time to ensure survival. There are three…

A: According to this question, they are asking for the population percentage at 0 years. And they have…

Q: 4. Distinguishing Differences of Non- Vascular Plants Group dispersal Liverworts Hornworts Mosses…

A: Bryophytes are group of simple , non - vascular plants that mainly inhabit in damp , moist area .…

Q: 1. Proteoglycans, such as heparan sulfate are defined as having sulfated glycosaminoglycans that are…

A: Proteoglycans are highly glycosylated proteins. A "core protein" with one or more covalently bonded…

Q: I need the answer as soon as possible

A: The proteasome is a very complex protease complex made to selectively, effectively, and methodically…

Q: QI. Drag and drop into each box in the biological passage the correct answer. There are two other…

A: There are more than 1.7 to 1.8 million species of living organisms describe and several more to be…

Q: Biology Answer the following questions (a)whats is citric acid cycle? why does this occur? where…

A: The hydrotrope and organic substance adenosine triphosphate (ATP) powers a variety of biological…

Q: Discuss how to transform the yeast vector, YEP containing your gene of interest into the host cell.

A: To insert a set of desirable foreign genes into the host genome for replication and expression, a…

Q: b. What if a breeder were working with 7 different, independently segregating genes, as Mendel did?…

A: Probability is a measurement used in genetics to forecast the likelihood that the desired trait will…

Q: Direction: Answer the following questions. 1. What distinguishes humans from other animals? Why? Can…

A: The humans who has a evolutionary past with their ancestors are highly civilized with several…

Q: If an organism grows as a mold at lower temperatures and grows as a yeast at higher temperat this…

A: Introduction: Mold or mould is the structures of certain fungi can form. Yeasts are single-celled,…

Q: In the 1970s, scientists realized that there might be unforeseendangers and ethical issues with the…

A: None men are islands. This adage applies to ecological creatures as well. No living thing survives…

Q: Fill in the space with the appropriate word from the word-bank below; causing During inhalation, the…

A: Inhalation is the process by which we take in oxygen-rich air. Exhalation is the process by which we…

Q: Cladistics analysis identifies clades based on Analogous structures unique to each group The ability…

A: A diagram showing evolutionary relationships within one or more clades is called a cladogram.

Q: Two animals of the same______ are able to breed to produce fertile offspring. A.Class B• Genus ©…

A: The relative position of an organism group (a taxon) within a taxonomic hierarchy is known as…

Q: Complete the punnett square below for a cross between AA and aa A Aa a a QUESTION 4 A Aa Complete…

A: The Punnett square is a square diagram that is used to predict the genotypes of a particular cross…

Q: what is the name of the fluid lest after clotting of blood? how is it different form blood

A: Blood is a vital fluid in our bodies. It carries oxygen and nutrients to our cells and helps to…

Q: Suppose that you perform an experiment to observe the effect of temperature and pH on the enzymatic…

A: Salivary amylase is an enzyme produced by the salivary glands that aid in the digestion of starch.…

Q: How did the colonists adapt to their natural environments

A: Introduction: The 'natural environment' refers to the non-human-made surrounds and conditions under…

Question

find out the plant pathogens have had a large impact on civilization over the years?

1.Claviceps purpurea
2.Saccharomyces
3.Phytophthora infestans
4.All of the above

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Which of the following plant pathogens has had a large impact on civilization over the years? 1. Claviceps purpurea2. Saccharomyces3. Phytophthora infestans4. All of the above
Historians report that 2500 years ago the Chinese learned to treat superficial infections such as boils by applying moldy soybean curds to the area. Can you suggest what this implies? - Please dont use the same answer that is already posted.
What is an organism that spreads disease germs to humans after biting and infected organism causes sickness
Which of the following plant pathogens have had a large impact on civilization over the years? Claviceps purpurea Saccharomyces Phytophthora infestans All of the above
Rhizobial bacteria (a) are used in the production of yogurt (b) produce antibiotics (c) cause peptic ulcers (d) are the pathogens that cause syphilis (e) form mutualistic relationships with the roots of legumes and fix nitrogen
Why were aflatoxins not discovered before the 1960s? Do you think this was the first time they had grown in a food product to cause disease?
WRITE A SIMPLE RESEARCH ABOUT COVID 19. HOW THIS PANDEMIC AFFECTED THE PLANT AND ANIMAL LIFE.
Create/Make a concept map about Systemic and opportunistic Mycoses. The main concept should be related to the functions of medical technologist about this type of fugal infection
Which statement DOES NOT describe the microbes on plants? A. May form a biofilm on the surface. B. Always belong to the aerobic microbe group. C. Can be found as epiphytes or endophytes. D. Maybe incidental, symbiotic or pathogenic.
What term describes the close association of a fungus with the root of a tree? a. arhizoid b. a lichen c. a mycorrhiza d. anendophyte
Which parasitic protist evades the host immune system by altering its surface proteins with each generation? a. Paramecium caudatum b. Trypanosoma brucci c. Plasmodium falciparum d. Phytophthora infrstans
Decomposing organic matter in soil is called ______ a. clay b. humus c. silt d. sand