TAC/ACC/GAC/GAA/AAT/TGT/TAC/CGT/TCA/AAC asap please If the mRNA molecule from your answer to the previous question is going to betranslated into a protein, what will be the amino acid sequence of the protein? Usethe genetic code chart below for help. Use the three-letter abbreviations for eachamino acid given in the genetic code below (for example, Phe or Leu), or else youranswer will be marked wrong!first baseCUUUU1UUCUUAUUGGUUGUCGUAGUGpheleuCUUCUCCUACUGAUUAUC ileAUAAUG met (start)leuvalUCUUCCUCAUCGCCUCCCCCAACUACAACGGCUGCCGCAGCG7//second baseserprothrala} tyrUAUUACJUAA StopUAG StopCAC hisCAACAGAAUAACAAAAAGginginasnlysGAUaspGACGAA 1GAG glu} glu/UGUcysUGCUGA StopUGG trpCGUCGCCGACGGGAGUAGC JAGAAGGGGUGGCGGAGGGargserarggly/DUAGUCAGDUAGULAGthird base

The gene is the portion of DNA that codes for a specific protein. First, the DNA is converted to…

If the mRNA molecule from your answer to the previous question is going to be translated into a protein, what will be the amino acid sequence of the protein? Use the genetic code chart below for help. Use the three-letter abbreviations for each amino acid given in the genetic code below (for example, Phe or Leu), or else your answer will be marked wrong! first base U A G UUU UUC UUA UUG CUU CUC CUA CUG U GUU GUC GUA GUG phe leu leu AUU ACU AUC ACC AUA ACA AUG met (start) ACG ile UCU UCC UCA UCG val C GCU GCC GCA GCG second base CCU CCC CCA pro CCG ser thr ala A UAC} tyr UAA Stop UAG Stop his CAU CAC CAA CAG gin AAU AAC} AAA AAG lys asn GAU GAC asp GAA GAGJ glu G UGC} cys UGA Stop UGG trp CGU CGC CGA CGG arg ser AGC AGG} arg GGU GGC GGA GGG gly DUAGUCANDUAGUAG third base

If the mRNA molecule from your answer to the previous question is going to be translated into a protein, what will be the amino acid sequence of the protein? Use the genetic code chart below for help. Use the three-letter abbreviations for each amino acid given in the genetic code below (for example, Phe or Leu), or else your answer will be marked wrong! first base U A G UUU UUC UUA UUG CUU CUC CUA CUG U GUU GUC GUA GUG phe leu leu AUU ACU AUC ACC AUA ACA AUG met (start) ACG ile UCU UCC UCA UCG val C GCU GCC GCA GCG second base CCU CCC CCA pro CCG ser thr ala A UAC} tyr UAA Stop UAG Stop his CAU CAC CAA CAG gin AAU AAC} AAA AAG lys asn GAU GAC asp GAA GAGJ glu G UGC} cys UGA Stop UGG trp CGU CGC CGA CGG arg ser AGC AGG} arg GGU GGC GGA GGG gly DUAGUCANDUAGUAG third base

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 1VQ

See similar textbooks

Similar questions

A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
If the sequence of mRNA is 5'-AAUCGUACGGAUGCCGAAAUACCCAUUAGGGAUUGCAUAGCGAGCAACGGAC-3', what is the amino acid sequence it would make? Note: Use one-letter abbreviation for the amino acid sequence Sample answer format: MIGHTY
Can you spell your name (or someone else's) using the one-letter amino acid abbreviations? If so, construct an mRNA sequence that encodes your "protein" name.
What do you mean by mRNA and tRNA?
Using the genetic code, interpret the following set of nucleotides. AUGGGUCCAUGGCGUAGGCCAAAUGAUGAGGAAUGA
Using the genetic code, translate your mRNA sequence of 60 nucleotides into a polypeptide. Use one-letter abbreviations for the amino acids. Enter one-letter abbreviations corresponding to the amino acids.
Why is DNA and not any other macromolecule represents the genetic code?
I would like to know how you find the non-transcribed DNA sequence when you are given a 5 prime to 3 prime mRNA sequence. For example; if you are given the mRNA sequence AUU ACA GUG UAU AAA, what would be the corresponding NON-TRANSCRIBED DNA sequence? The mRNA sequence that I listed is 5 prime to 3 prime
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand?
If there are 64 possible codons in the genetic code and the amino acid is specified by each, as read in the 5’ to 3’ direction from the mRNA sequence, which ones are STOP codons?
What do you mean by ordered genetic code ?
Suppose you are provided with a sequence of nucleotides. How would you determine if the sequence is of mRNA, tRNA, or DNA molecules?