Student GuideD. How many times would you expect to find a specific 20 base pair sequence in thehuman genome? Part 3. Compare the Specificity of DNA-Cutting ToolsThe flexibility and specificity of CRISPR-Cas9 technology offer a large step forward for gene editing.The first DNA "scissors" were restriction enzymes, which cut DNA at predefined sequences, typically4-8 base pairs long. For example, EcoRI, a restriction enzyme found in E. coli, will cut double-stranded DNA at every GAATTC sequence. If EcoRI were added to a sample that contained the entirehuman genome, it could cut at every GAATTC sequence.We can calculate the probability that a particular nucleotide sequence, such as GAATTC, will occurwithin a larger sequence. Table 1 below shows the calculated probabilities of finding sequences ofparticular lengths. These calculations are based on the assumption that DNA sequences are entirelyrandom and that every nucleotide position has an equal probability of being A, T, C, or G. Use thetable to answer the following questions.Table 1. Calculated probabilities of finding a specific sequence.SequenceSequence Probability CalculationLengthAACGAATTC (EcoRI)NNNN...12COn14 = (1/4)¹ = 0.251/4*4 = (1/4)² = 0.0625¼*14*¼*¼*¼*¼ = (1/4)6 = 2.44 x 10-414*14*14*. (1/4)Predicted Occurrence in aSequence the Length of the HumanGenome (3,234,830,000 bases)808,707,500202,176,87589,753(1/4)n* 3,234,830,000

The total number of base pair sequences in the human genome is 3 billion base pairs or 3 * 109 base…

Answered: D. How many times would you expect to…

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter13: An Introduction To Genetic Technology

Section: Chapter Questions

Problem 19QP

See similar textbooks

Similar questions

Why are antibiotic resistance markers such as ampR important components of bacterial plasmid cloning vectors? a. The plasmid must have resistance to accept DNA inserts. b. They allow the detection of plasmids that contain an inserted DNA fragment. c. They ensure the presence of the ori site. d. They ensure that the plasmid can be cut by a restriction enzyme. e. They allow identification of bacteria that have taken up a plasmid.
27. You have a DNA sequence of 1400 bp. To characterize it, you decide to make a restriction map. Cutting with the first enzyme, you show by electrophoresis that the fragments produced are 400 and 1000 bp, respectively. After using the second enzyme, you recover 600-bp and 800-bp fragments. After treatment with both enzymes, fragments were 200, 400, and 800 bp. Draw the correct restriction map.
1.Briefly explain the rationales of adding chemicals that can affect DNA stability in a polymerase chain reaction (PCR). 2.Why DNA melting is required in PCR? Briefly explain how PCR can be used to detect DNA mutation.
ques 1 . A small DNA molecule was cleaved with several different restriction nucleases, and the size of each fragment was determined by gel electrophoresis. The following data were obtained: Enzyme Fragment size (kb). EcoRI 1.3, 1.3 Hpall 2.6 HindIII 2.6 EcoRI+Hpall 1.3, 0.8, 0.5 EcoRI + HindIII 0.6, 0.7, 1.3 a. Is the original molecule linear or circular? b. Draw a map of restriction sites, showing distances between sites, that is consistent with the data presented. ques 2. You have double-stranded DNA that you radioactively label at the 5' ends. Digestion of this molecule with either EcoRI or BamHI yields the following fragments. The numbers are in kilobases (kb) and an asterisk Indicates the fragments that are unlabled EcoRI: 2.8, 4:6, 6.2*, 7.4, 8.0* BamHI: 6.0%, 10.0", 13.0 IF unlabeled DNA is digested with both enzymes simultaneously, the fragments 1.0, 2.0, 2.8, 3.6, 6.0, 6.2,7.4. What is the restriction map for the two enzymes?
1. The extraction of DNA is a common procedure in biotechnology research laboratories. Research the methods of extracting DNA in biotechnology facilities. Describe how the extraction methods used in this lesson compare to those of research laboratories.
Part 3. Restriction Enzymes 1) Consider the sequence of DNA given below and answer the following questions 5’ ATTGAGGATCCGTAATGTGTCCTGATCACGCTCCACG 3’ 3’ TAACTCCTAGGCATTACACAGGACTAGTGCGAGGTGC 5’ a) You cut the sequence of DNA shown above using BamHI (see table 19.1 from the text). How many fragments of DNA would you expect to result from this restriction digest? b) If you cut the sequence of DNA shown above using BclI (recognition sequence = 5’ TGATCA 3’, enzyme cuts after the first T) instead of BamHI how many fragments do you expect? 2) For each given sequence/restriction enzyme pair, determine how many pieces of DNA would result form the digest and indicate whether those pieces would have blunt or sticky ends. NOTE: in the given recognition sites, the dash represents where the cut is made. a) HpaI, recognizes 5’ GTT – AAC 3’ 5’ GGATGTTAACAATCTCTACGGGTTAACACCCTTGGGTTAACATCCGCGG 3’ 3’ CCTACAATTGTTAGAGATGCCCAATTGTGGGAACCCAATTGTAGGCGCC 5’ Number of fragments of DNA:…
the most efficient general strategy for whole genome sequencing is ? (a) double the coding sequence after sequencing the proteins (b) shotgun sequence and assemble based on overlaps (c) identify mutations that affect glycolysis (d) obtain recombinant DNA clone maps before starting the sequencing (e) obtain comprehensive SNP maps before determining the order of DNA clone
Replicating dna polymerases have high fidelity A why is high fidelity more importsnt for dna polymerase than rna polymerase b list 2 mechanisms dna polymerase 3 used to reduce errors c despite high fidelity dna polymerase makes errors which type of sequence leads to strands slippage what what types of mutations occur ( transversion, insertion, deletion, transition ) when slippage occurs
If we extract DNA of a pool of cells, will that impact the DNA sequencing? In other words, having more than one cell will affect the DNA sequence of our sample? Same as 1, but with RNA. Cite one problem you expect when investigating a pool of cells.
Part 4. Putting It Together 1) Consider the diagram below as well as the given information. This diagram represents a piece of circular DNA which was cut in 4 separate reactions (4 different test tubes, each with some of this DNA in it). One digest was done with AvaI, another with ClaI, a third with EcoRV, and a fourth with ScaI. The locations of the recognition sequences for each restriction enzyme are shown along with the location of that site in bp along the circle (it goes clockwise from position 1). You run an agarose gel with a molecular weight marker in the first lane, the AvaI digest in lane 2, the ClaI digest in lane 3, the EcoRV digest in lane 4, and the ScaI digest in lane 5. a) Use the space below and draw out the agarose gel described above. Use your drawing to answer the next questions. b) How many bands of DNA are there in lane 3? c) How many bands of DNA are there in lane 5? d) There would be 2 bands of DNA in lane 4. How big are they? e) Which lane…
DNA cloning isa. making multiple genetically identical cells.b. making multiple copies of a piece of DNA.c. inserting DNA into a cell.d. changing the nucleotide sequence of a strand of DNA.
How does that length compare to that of restriction enzymes? Implications? 2. can you conceive of any potential applications of CRISPR technology?

SEE MORE QUESTIONS

Recommended textbooks for you

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS

D. How many times would you expect to find a specific 20 base pair sequence in the human genome?