Define transcription and translation. Which process occurs first to make protein from DNA? 2. In what direction does a polymerase move when synthesizing a strand of mRNA?
Q: 2. What happens during translation? is read and Possible sentence frame: Translation is the process…
A: The protein synthesis occurs in cytoplasm by the process of translation.
Q: Write the order of nucleotides in mRNA that would be transcribed from the following strand of DNA:…
A: Hi, Thanks For Your Question. Answer : Let's Learn Some Basic Concepts First: Transcription : It Is…
Q: occasionally, an effor occurs during DNA replication that changes the nucleotide sequence. Aven that…
A: The process by which DNA is copied to RNA is called transcription, and that by which RNA is used to…
Q: Write the mRNA sequence that remains after the deletion. Use the codon table to write the sequence…
A:
Q: 7) A strand of MRNA that is 450 nitrogenous bases long will produce a protein containing…
A: Living cells use a collection of rules called the genetic code to translate information found in…
Q: 1. What would be the amino acid sequence encoded by the mRNA 5' C C A U G A C G U C G G A U C A A U…
A: Only proline amino acid form as second codon is stop codon here
Q: What is a consensus sequence? What are the components of RNA polymerase and what are their functions
A: RNA polymerase is an enzyme that catalyzes the synthesis of RNA from RNA template.
Q: Considering each nucleotide sequence in an mRNA molecule: [1] write the sequence of the DNA template…
A: Gene expression is the process by which the instruction in the DNA is converted to products through…
Q: For each DNA segment: [1] What is the sequence of the mRNA molecule synthesized from each DNA…
A: Gene expression is the process by which the instructions in the DNA is converted into a functional…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The flow of genetic information from DNA to RNA, RNA to protein synthesis is called central dogma.…
Q: 1. Describe at least four ways in which transcription is different from DNA replication.
A: As per our company's guidelines we are supposed to answer a single question at a time only. Please…
Q: 8. Some antibiotics work by preventing protein synthesis in bacteria by binding to their ribosomes.…
A: Multiple choice answer is given below:
Q: Why aren't ssb proteins necessary in transcription?
A: The function of SSB protein is to prevent the recoiling of parent strands during replication. As we…
Q: 1. What are the types and major functions for each type of RNA?
A: NOTE: Since you have asked multiple question, we will solve the first question for you. If you…
Q: 5’GCTATAAAGCGTATCGCGTCATA 3
A: Complementary mRNA 5’GCT ATA AAG CGT ATC GCG TCA TA '3 3'CGA UAU UUC GCA UAG CGC AGU AU '5
Q: 1. During RNA splicing, the of the precursor mRNA are being removed. Exons Introns Promoters…
A: RNA splicing is a process by which non coding sequences of RNA are removed. The coding sequences…
Q: .Describe the process of transcription in prokaryotes, then explain how proteins can be targeted for…
A: The bacterial genome is comprised of circular DNA present in the cytoplasm and does not have…
Q: 1. What is called the functional unit of a DNA molecule that may code for RNA or protein? A. arnino…
A: DNA or deoxyribonucleic acid is the molecule that is made up of polynucleotide chains coiled around…
Q: 1. A certain mRNA codon is determined to be AUG. a. What is the tRNA anticodon? b. What is the DNA…
A: Transcription is the transfer of genetic information from sequence of DNA to RNA, Transcription…
Q: 1. What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’?
A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…
Q: 6. Describe transcription, include the following terms: mRNA, RNA polymerase, promoter, template…
A: "Transcription" and "Translation" are two important processes that take place inside the cell for…
Q: 2. If the DNA strand AAA TCG AGG CCA is transcribed to an mRNA, which 2 points shows an occurrence…
A: Note: As Per Guidelines, We Can Answer One Question At A Time. Ask Again To get rest answers.…
Q: Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA
A: Ribonucleic acid (RNA) is a genetic material that is prepared from the deoxyribonucleic acid (DNA)…
Q: 7. An original strand of DNA has the following sequence of nucleotides: NNNNONNNNNNINN CC AT CTGGA…
A: DNA (deoxyribonucleic acid) and RNA (ribonucleic acid) are polymeric molecules essential in various…
Q: What is the sequence of bases in the template strand of DNA that codes for the mRNA in Problem?
A: The sequence of mRNA given in the problem is 5'AAA GUU GGC UAC CCC GGA AUG GUG GUC 3' and the…
Q: 5. What mutation(s) would eliminate peptide translation? Nonsense mutation
A: In the given case, the sequence of DNA is given. The RNA contains uracil in place of thymine. Thus…
Q: How would you explain the three steps of DNA transcription
A: RNA strands are formed from the DNA strands by transcription. DNA strand contains the…
Q: What are the components of the initiation complex for translation
A: Translation is a process in which codon of mRNA code for specific amino acid. These amino acid…
Q: 1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA…
A: The process of the formation of the mRNA from the DNA is called as transcription. The process of the…
Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…
A: The central dogma of molecular biology involves the processes of transcription and translation that…
Q: 5’ AGGATCAACACCTGTACATGG 3’ 3’ TCCTAGTTGTGGACATGTACC 5’ Label the sense and antisense strands…
A: DNA is ladder like , helical structure which have ability to form its own copies via DNA replication…
Q: How many codons are there in the mRNA?
A: Here, the given original DNA sequence is: 5'ATGCCTGGACGCAATGCGAGCTGGCTTAACTCAGGGCGTTGA3' So,the mRNA…
Q: 9. What is the role ol RNA polymerase? To answer the question please: 1) name three types of RNA in…
A: RNA: It is made up of repeating strands of nucleotides which contain all the three parts (nitrogen…
Q: What is the main difference in the behavior of DNA and RNA polymerases?
A: Both DNA polymerases and RNA polymerases are enzymes.DNA polymerases are mainly involved during the…
Q: 7. Complete the following diagram which describes a small eukaryotic open reading frame, by filling…
A: Genes are the fundamental unit of heredity. They store genetic information in the form of DNA, which…
Q: What strand of mRNA would be synthesized from a template DNA strand with the sequence GATGTTTAC…
A: The information from the DNA is transferred to RNA by transcription. The information present in the…
Q: 8. Consider the following strand of mRNA. a. What would the original template DNA have been? b. What…
A: The central dogma of molecular biology is the metabolic process by which the DNA was converted into…
Q: 1. how is information from the DNA passes on from one cell to another? 2. How does the structure of…
A: Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: 1. What are the differences between DNA and RNA? 2. What are the similarities between DNA and RNA?
A: Hereditary component of a cell which contains the information of the body and can be transmitted…
Q: 5. For each statement, choose the letter that applies the best: P for prokaryote, E for eukaryote, B…
A: Prokaryotes are characterized by the absence of nucleus and membrane bound organelles of eukaryotes…
Q: 5. Compare and contrast transcription and translation. Transcription Translation What is the Start…
A: The central dogma of molecular biology explains the conversion of genetic information from DNA to…
Q: 4. Draw and label the Transcription process. 5. Draw and label the Translation process.
A: Transcription is the process in which RNA is made from DNA, while translation is the process in…
Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…
A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…
Q: II. Give the translation of the segment of a polypeptide chain below. Specify your template strand.…
A: Translation is process in which proteins are synthesized.
Q: 4. A mutation changes a nonsense codon to an amino acid sequence. Write an example of such a…
A: Mutation is any change in the sequence of DNA that causes a change in the protein that is…
Q: 1. Transcription: Write out the sequence of mRNA that would result from transcription of the…
A: The central dogma The central dogma is the process involving three major events in cells these are…
Q: Protein synthesis, begins with a process known as pre-initiation. Explain three scenarios that would…
A: Initiation factors are proteins binding to the smaller subunit of the ribosome during the initiation…
1. Define transcription and translation. Which process occurs first to make protein from DNA?
2. In what direction does a polymerase move when synthesizing a strand of mRNA?
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- 1. How are nucleotides formed? In details summarize the process of DNA replication. In details summarize the process of Translation and post translation process. In details summarize the process of transcription. Explain how do you sequence the DNA1. What are the types and major functions for each type of RNA? 2. Define transcription and translation. Which process occurs first to make protein from DNA? 3. In what direction does a polymerase move when synthesizing a strand of mRNA?1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
- 3. Briefly describe the function of the following in protein synthesis: a) rRNA, b) tRNA c) mRNA2. How many codons are there in the mRNA?1. Determine what amino acid will be formed from the given DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ 2. how will replication happen by mentioning the enzyme needed then transcribe to form mRNA. 3. Discuss what will happen to mRNA, then translate, mentioning the anticodon to be used 4. Look at the genetic code to know what amino acid will become part of the polypeptide chain.
- 7( what is the diagram depictin A) transcription and translation return B. DNA replication C -DNA replication transcription and translation D-transcription E- translation 1. What mRNA sequence is synthesized from a section of DNA that is 3’-TTGACCT-5’? 2. In what direction does a polymerase move when synthesizing a strand of mRNA? 3. Define transcription and translation. Which process occurs first to make protein from DNA?1. Discuss the difference between intron and Exon
- 1. What is the main difference in the behavior of DNA and RNA polymerases?1. how is information from the DNA passes on from one cell to another?2. How does the structure of a DNA molecule hellp account for the great variety of life that exists on earth?3. Does your mRNA model more closely resemble the DNA strand from which it was transcribed?4. Explain how the structure of DNA enables the molecule to be easily transcribed. Why it is important for genetic information?5. Why is RNA important to the cell?6. How does the mRNA molecule carry information from DNA?4. The structures within living cells that contain the genetic material is called A Chromosome B. Nucleosome C. Ribosome D. Nucleolus