Describe the differences between the hair seal family (Phocidae) and the eared seal family (Otariidae) for the following features: External ear pinnae How do they move on land? How do they move in the water (specific movement of fore and hind flippers – look up videos and report what you see).

Describe the differences between the hair seal family (Phocidae) and the eared seal family (Otariidae) for the following features: External ear pinnae How do they move on land? How do they move in the water (specific movement of fore and hind flippers – look up videos and report what you see).

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter27: Introduction To Animal Diversity

Section: Chapter Questions

Problem 3VCQ: Figure 27.9 Which of the following statements about diploblasts and triploblasts is false? Animals...

See similar textbooks

Related questions

Q: Question 5 Except for the all secondary lymphoid organs have thymus; high endothelial venules O…

A: Secondary lymphoid organs are specialized tissues in the lymphatic system that play a key role in…

Q: How do proteins that are destined for secretion out of the cell (e.g. hormones) travel from the ER…

A: Introduction For all living cells, transport through membranes is an essential activity. Membranes…

Q: Give typed full explanation Given the following sequence of RNA, propose the potential hairpin…

A: A hairpin structure is a secondary structure of nucleic acids, such as RNA or DNA. It forms when a…

Q: Mapping quantitative trait loci (QTL) through lab crosses is one way to find the genetic variants…

A: Quantitative trait locus (QTL) mapping is a genome-wide inference of the relationship between…

Q: 1. Discuss the following statement briefly: Eutrophication can be a natural process 2. What is the…

A: Ecology: Ecology is the scientific study of the relationships between living organisms and their…

Q: What are the inputs and outputs for latic acid fermentation? What are the inputs and outputs for…

A: Introduction Fermentation is a metabolic process that occurs in the absence of oxygen (anaerobic…

Q: "On the rapidity of antibiotic resistance evolution facilitated by a concentration gradient" Full…

A: Antibiotic resistance evolved naturally in response to the selective pressure of antibiotic use.…

Q: The patient has a significant decrease in blood hemoglobin. No blood loss was observed. Diet and…

A: Introduction Hemoglobin (often spelled haemoglobin) is a protein molecule found in red blood cells…

Q: What is natural selection and how does it drive evolution?

A: Introduction: Natural selection is a process that drives evolution by selecting the fittest…

Q: 6. Annealing Temperature (Ta): • The primer melting temperature is the estimate of the DNA-DNA…

A: We are supposed to answer 3 subpart of a question, please post other questions separately. PCR is…

Q: Did the authors discover any microbes present that should be cause for concern, in your opinion (and…

A: Gouda cheese is a popular semi-hard cheese that originated in the Netherlands. It is typically made…

Q: 1.Explain three reasons why Koch’s postulates are difficult to carry out today and why it can not be…

A: The bacterial infection known as tuberculosis (TB), which is contagious, primarily affects the lungs…

Q: Name at least three reasons that could explain why the giant panda’s habitat has been reduced to…

A: INTRODUCTION Giant Panda Giant Panda is an endemic bear species in china.

Q: Is bone marrow a type of tissue? Is cartilage a type of tissue?

A: Introduction A collection of like cells that collectively carry out a particular task for the body…

Q: provide a full Description of the simiarlities and differences between the fish, pork and beef tap…

A: A tapeworm is a parasitic flatworm that lives in the intestines of animals, including humans. They…

Q: Skin color in humans is determined by a polygenic inheritance system. The husband is white while the…

A: Polygenic inheritance is a mode of inheritance in which a particular trait is determined by the…

Q: 4. Consider the process of conjugation. Describe the process in terms of the cell that donates the…

A: Bacteria are single-celled microorganisms that belong to the domain of prokaryotes. They are some of…

Q: Which of the following would you NOT expect with respect to variation in neural conduction velocity?

A: During development, neural conduction speed rises as Schwann cells create myelin sheaths to protect…

Q: Match the enzyme complexes of the respiratory chain in the left column with the appropriate…

A: The respiratory chain also referred to as the electron transport chain is a step in the process of…

Q: There are skin illnesses that look different on Caucasian and on some other race's skin. 1) Find…

A: Introduction Skin is the largest organ of the human body and is composed of several layers of…

Q: Circle the section on the DNA template where the example primer would bind.

A: A primer binds to a specific region of a single-stranded DNA template, known as the primer binding…

Q: Why can we use temperature sensitive genetic screening to identify particular mutants within a…

A: Temperature-sensitive (TS) mutations are rare alleles that are used to study the expression of…

Q: Titration volume (ml) Water Body X DO sample (0) DO blank (0) DO sample (5) DO Blank (5) 2.Calculate…

A: Introduction: BOD stands for Biochemical Oxygen Demand. It is a measure of the amount of oxygen…

Q: Characterize and identify the Genus of the following cyanobacterium Genus Identification of…

A: Cyanobacteria, also known as blue-green algae, are a group of photosynthetic bacteria that are…

Q: Draw a cladogram of the 3 Classes of Platyhelminthes and add 1 outlier from another Phylum. Make…

A: The phylum Platyhelminthes includes three classes: Turbellaria, Trematoda, and Cestoda. Turbellaria…

Q: QUESTION 8 Describe: Environmental-Press (Ecological Model) and Selective Optimization with…

A: An ecological model is a conceptual or mathematical representation of an ecosystem or ecological…

Q: Compare the ST and CT treatments in Figure 4 to the other treatments (T1, T2, T3, and T4). What do…

A: The research examined in this subject looked at the impact of several fungus species on the…

Q: Describe the main stages in the formation of a blood clot and evaluate the importance of specific…

A: Introduction Blood is a fluid connective tissue that circulates throughout the body, delivering…

Q: Example: The aspect of meiosis that is most like mitosis: "It starts with a cell splitting in two"…

A: Meiosis is a type of cell division that occurs in sexually reproducing organisms, which involves the…

Q: Which family of guidance proteins contains both diffusible and contact guidance molecules? a) CAMS…

A: Introduction : Guidance proteins are a diverse group of signaling molecules that guide the growth,…

Q: If Dr. Velazquez was asked to review an article on the possibility of targeted mutagenesis of the…

A: Targeted mutagenesis is a technique used for precisely modifying specific DNA sequences. It involves…

Q: Write an equation for lipids with KOH and heat and then explain any differences between the three…

A: Saponification is a chemical reaction, which have a variety of uses in industries such as…

Q: How is ATP produced in chloroplasts?

A: Introduction Chloroplasts are organelles found in plant cells and some other eukaryotic organisms,…

Q: Give typing answer with explanation and conclusion Detail the approach of DNA vaccination versus…

A: Introduction: Vaccines are biological preparations that stimulate the immune system to recognize and…

Q: Characterize and identify the Genus of the following cyanobacterium Genus Identification of…

A: Cyanobacteria, also known as blue-green algae, are a phylum of photosynthetic bacteria that obtain…

Q: What is the nursing responsibilities during the procedure in CT Scan?

A: Introduction The goal of the nursing profession is to help people who require medical care,…

Q: Jon is a member of population A in which the general risk for cleft lip is 0.0008. Jon’s mother, two…

A: The probability that Jon carries the gene for cleft lip can be calculated using the information…

Q: The student is to include at least 3 other events. The events must relate to the history of Earth,…

A: The assignment given here is related to the timeline of the various evolutionary events that…

Q: 5' AGGCC TAAGTTCCCTCACACACACAGGG 3' 3¹ TCCGGATTCAAGGGAGTGTGTGTGTGCCC 5' B a mutation in an exon can…

A: Genes are hereditary structures on genetic material. These control some specific particular traits.…

Q: A 2 year old girl presents with a fever and dizziness. She has developed a characteristic rash on…

A: A viral infection is a type of infection caused by a virus. Viruses are small infectious agents that…

Q: 56-year-old woman is brought to the emergency department because of substernal chest pain and…

A: Introduction: A non-invasive examination called an ECG is used to track the electrical activity of…

Q: 3. Which symbols would you use to represent the genotype of an individual who is lactose tolerant?…

A: Introduction Genetics is a branch of science which deals with the study of gene and inheritance.…

Q: Bromelain is a protease, therefore it breaks down the polymer ________ releasing __________…

A: Bromelain: As a nutritional supplement, bromelain is recommended for lowering discomfort as well as…

Q: How does a change in the circulatory system organization support the body designs in cephalopods…

A: Cephalopods, such as octopuses and squids, are highly specialized mollusks that have evolved a…

Q: Case study 1 Melanoma A 50-year-old woman presented one year ago with a skin lesion, a biopsy was…

A: Cancer is a complicated illness caused by a variety of hereditary and environmental variables. The…

Q: Use this graph showing the standard death curves of three microbial species to answer the following…

A: By understanding the given graph the questions related to the graph are solved as follows:-

Q: When organisms acquire energy from the food web where in their cells do they store this energy?

A: A food web is a complicated network of linked food chains that shows how nutrients and energy move…

Q: How do the authors of the study interpret the information shown in Figure 3? (Choose one.) Group of…

A: Mann-Whitney U test is a nonparametric statistical test used to compare two independent samples to…

Q: Are changes that cause high FST found equally across the genome? Explain why or why not.

A: Introduction: A genome is the complete set of genetic instructions encoded in the DNA of an…

Q: A dog breeder thinks that he will be able to charge higher prices for extra-tiny versions of small…

A: Narrow sense heritability is a measure of how much genetic factors influence trait variation within…

Concept explainers

Communication

Communication is a method of transferring information between two persons or organisms. Communication is possible using mutually understood behaviors such as signs, symbols, or language. In the year 1980, S. F. Scudder proposed communication theory. According to his ideas, all living beings on the earth communicate, but the methods of communication differ. Communication skills are now part of soft skills.

Question

Describe the differences between the hair seal family (Phocidae) and the eared seal family (Otariidae) for the following features:

External ear pinnae
How do they move on land?
How do they move in the water (specific movement of fore and hind flippers – look up videos and report what you see).

Describe a two-year cycle in the life of an adult female gray whale by answering the specific questions below.

Where do they mate and give birth?
How often do they give birth?
Where do they spend the non-breeding season? (Note this is also where they eat because they don’t typically feed during migration or on their breeding waters.)
When do they migrate south along the Oregon Coast?
When do they migrate north along the Oregon Coast?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

Describe a two-year cycle in the life of an adult female gray whale by answering the specific questions below. Where do they mate and give birth? How often do they give birth? Where do they spend the non-breeding season? (Note this is also where they eat because they don’t typically feed during migration or on their breeding waters.) When do they migrate south along the Oregon Coast? When do they migrate north along the Oregon Coast
Which of the following feature is exclusively present in members of class Mammalia? 1.Pulmonary respiration 2.Oviparity 3.Mammary glands 4.Homoiothermy
In amniotes the cochlea and semicircular canals of the inner ear cavity are filled with _______. fluid air a gelatinous substance neuromast cells otoliths
Figure 27.9 Which of the following statements about diploblasts and triploblasts is false? Animals that display radial symmetry are diploblasts. Animals that display bilateral symmetry are triploblasts. The endoderm gives rise to the lining of the digestive tract and the respiratory tract. The mesoderm gives rise to the central nervous system.
What is the difference between a postorbital bar and fully enclosed eye sockets? What is a bony ear tube? Where is it located? Which larger group of primates has bony ear tubes and which does not?
The larger eye sockets in the skulls of Acanthostega and Ichthyostega suggest that they were ______. living in extremely deep regions of the ocean where very little light would have penetrated using their eyes in air, where increasing eye size would have increased their visual range much more than in water relying on vision to escape the large predators swimming far above them in the ocean
A terrestrial animal species is discovered with the following larval characteristics; exoskeleton, system of tubes for gas exchange and segmentation. It can be predicted that these species would feature ( eight legs/ two pairs of antennae/ a sessile lifecycle/ open circulatory system)?
Given the following images of primate skulls: What is the function of the brain crest? If a primate does not have a crest, what does it say about the primate? How are the sizes of the forehead and temporal area related to the volume or size of the brain?
Which of the following is a structure that frogs utilize to breathe? -gills -lungs -all three of the answers in this list are correct -skin/cutaneous respiration
Which of the following structures is not an extra-embryonic membrane of amniotes? Question 17 options: The allantois The pharyngeal cleft The chorion The yolk The amnion
why is it that higher forms of animals are bilaterally symmetrical? provide scientific explanations please do not copy from google
Pharyngeal slits are which of the following? Question 24 options: a) Openings in the pharynx. In aquatic chordates they allow for exit of water that enters the mouth. b) Elongations of the posterior portion of the body. Use for locomotion in fish, or balance in some terrestrial vertebrates. c) Flexible, rod-shaped structures that grows from mesoderm. Gives support to an animal in embryonic development of chordates or for entire life depending on the species. d) Tissues that produces thyroid type hormones. e) Hollow tubes that develops from ectoderm. Develops into the central nervous system.