Answered: Name 3 structural features of the DNA…

Science

Biology

Name 3 structural features of the DNA and how they help the DNA perform its functions

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 12QP: DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What...

See similar textbooks

Related questions

Q: If the DNA of chromosome 1 is fully extended, it will exceed the diameter of the nucleus of a cell…

A: DNA packaging is done in order to fit the linear DNA molecule inside the nucleus. Is starts when DNA…

Q: How many subunits does the E. coli DNA polymerase I have? Select one: O a. 5 Оb. 10 О с. 1 O d. 3

A: RNA polymerase is required for the transcription of DNA into RNA. It is also important in the study…

Q: Draw the full structure of the DNA dinucleotide C-T. Identify the 5′ and 3′ ends of this…

A: Deoxyribonucleic (DNA) acid is a double helix structure, which is composed of nucleotides joined by…

Q: AAUCCCAAU ITTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGG-W' JAATCCCAATCCCAATCCCAA-X' Figure 3 (i) Label the…

A: Telomeres are the structures(caps) that are present at the end of the chromosomes, their fhbction is…

Q: outline 4 differences between the leading and lagging strand of DNA replication

A: Leading strand. 1.It is a replicated strand of DNA which grows continuously without any gap 2. It…

Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: The formation of a double-stranded structure must obey the rule that adenine hydrogen bonds to…

A: In molecular biology, nucleic acid is defined as long-chain molecules composed of similar types of…

Q: In one, simple sentence define the function of the following 1. Helicase = 2. Alpha subunit of…

A: DNA helicases are essential during DNA replication because they separate double-stranded DNA into…

Q: 1 a)The nucleotide sequence below is one half of a double stranded DNA sequence. The highlighted…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: Name three important functions of DNA.

A: DNA is deoxyribonucleic acid which acts as genetic material in all organisms present on Earth. DNA…

Q: COMPLEMENTARY

A: COMPLEMENTARY DNA SEQUENCE OF GACGGCTTAAGATGC is given below

Q: • In a ______________, DNA wraps twice around a corecomposed of histones H2A, H2B, H3, and H4.…

A: Chromosomes are the structure in which genes are located. Eukaryotic chromosomes are composed of…

Q: DNA polymerase functions from 5’ to 3’ direction. Explain this sentence. You

A: The DNA has been unraveled and unzipped. The helical structure has been unraveled. Special chemicals…

Q: Describe in detail the semi Conservative replication of the DNA double helix structure

A: Earlier, it was proposed that DNA replication in an organism could occur in three ways following the…

Q: Refer to the image and answer the questions 1. How are Okazaki fragments joined together? 2. Where…

A: The replication fork is a structure that forms within the long helical DNA during DNA replication.…

Q: Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the…

A: The change in nucleotide is called a mutation. it could be a point mutation when one nucleotide is…

Q: Determine what amino acid will be formed from the given DNA strand below:…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: DNA Polymerase Holoenzyme Il is represented below. It consists of several domains with distinct…

A: At the replication fork, DNA polymerase III holoenzyme (Pol III HE) works with the helicase and…

Q: To test you further whether you understand the processes involved in the Central Dogma of Molecular…

Q: Discuss the importance of the discovery of the double helical structure of the DNA.

A: DNA is the genetic material in most organisms. It is the larges biomolecule in the cell. It is…

Q: Name 2 differences in the structural features of DNA and RNA and indicate the relevance of each…

A: RNA and DNA are the two types of nucleic acids present in the living system. Nucleic acids are…

Q: For the DNA structure below write the correct base sequence in the form: 5-АТСТ-3 3'-TAGA-5 Make…

A: DNA or deoxyribonucleotide is the genetic material that is present in the higher organisms like…

Q: 19. You have reasonably short, typical, double stranded DNA sequence. Basically how many proteins…

A: DNA's molecular structure is referred described as a "double helix." Two connected strands that…

Q: non-coding DNAs can be put into two groups

A: Part of DNA that does not encode a protein sequence is called as non coding DNA. tRNA, rRNA and…

Q: Describe the structure of DNA. The two strands of DNA are antiparallel. What does the term…

A: DNA contains all organism's order for growth, survival, and reproduction. DNA sequences must be…

Q: 3' - AACCAGTGGTATGGTGCGATGATCGATTCGAGGCTAAAATACGGATTCGTACGTAGGCACT - 5' Q: Based on written…

A: The DNA has two strands one is the Template strand and other is the coding strand. Based on the…

Q: B D A E 1. The RNA primer is denoted by letter 2. The leading strand is denoted by letter 3. The…

A: The DNA replication involves synthesis of new DNA from the old DNA by semiconservative mode. The DNA…

Q: 4. (a) Create the complementary strand for the DNA strand below. Make sure to write the direction of…

A: DNA is a polynucleotide molecule that stores genetic and hereditary information. DNA is a…

Q: Mention and explain 4 characteristics of the Structure of DNA.

A: DNA- Deoxyribose Nucleic Acid

Q: Uniquely describe the chemical and physical structure of DNA in your own words.

A: DNA or deoxyribonucleic acid which are made up of molecules known as Nucleotides where each…

Q: Can you: describe the 2 D and 3 D structure of DNA including the bonding that takes place

A: DNA as genetic material in all the living organisms.

Q: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’ Complementary DNA…

A: In this question, we are given with a sequence of DNA which has a mutation. Given DNA sequence is…

Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…

Q: mino acid will become part of the polypeptide chain. 1. Partner DNA strand 2.…

A: Organism divides their genetic materials by cell division as a result they pass on their genetic…

Q: Determine what amino acid will be formed from the given DNA strand below:…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction:…

Q: List the four types of noncoding DNA (see Section 27.2). Give the function of each, if it is known.

A: Noncoding DNA is the part of the DNA that does not code for any proteins. Noncoding DNA accounts for…

Q: DNA strand below: 3’ T A C A T G C C G A A T G C C 5’ Discuss how will replication happen by…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: DNA Structure Provide a detailed (hand-drawn) structure of the double-stranded DNA GGATCC

A: DNA is a nucleic acid. DNA is polymer of nucleotides. Nucleotide is composed of pentose sugar,…

Q: T. aquaticusgenomic DNA is 34.3% guanosine nucleotides. What fraction of the DNA is adenosine…

A: Chromosome is a storehouse of genetic information. Each chromosome is made up of DNA (…

Q: Describe four differences between A and B forms of DNA

A: DNA is composed of four different types of nucleotides attached together via phosphodiester bonds.…

Q: 3. Illustrate a 15 nucleotide DNA molecule. Use the symbols: P for phosphate, S sugar and N…

A: DNA is a polymer of nucleotides which are linked to each other by 3'-5' phosphodiester bond.

Q: Name: Activity #20: DNA Structure Directions: You may need your textbook to identify the nucleotides…

A: DNA is the double helical structure that is found in the living organisms like humans, plants,…

Q: Enumerate 5 important features of the DNA. Choose ONE from your list and elaborate on how this…

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…

Q: 1) The nitrogenous bases content of a sample of DNA was found to be 3.2% adenine. Determine the…

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: Name an important difference in the replication of circular DNA versus linear double-stranded DNA.

A: Replication: Replication is the process to copy old DNA into new DNA strands (genetic material),…

Question

Name 3 structural features of the DNA and how they help the DNA perform its functions

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

DNA contains many hydrogen bonds. Are hydrogen bonds stronger or weaker than covalent bonds? What are the consequences of this difference in strength?
Figure 3.33 A mutation occurs, and cytosine is replaced with adenine. What impact do you think this will have on the DNA structure?
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
How does the double helix structure of DNA support its role in encoding the genome? The sugar-phosphate backbone provides a template for DNA replication tRNA pairing with the template strand creates proteins encoded by the genome Complementary base pairing creates a very stable structure Complementary base pairing allows for easy editing of both strands of DNA.
Mention and explain 4 characteristics of the Structure of DNA.
Draw the following strands of DNA5’ C-A-T 3’ as well as the complementary base pairing strand hydrogen bonded to itIt should be drawn in detail, structurally.
non-coding DNAs can be put into two groups, name them
Describe four differences between A and B forms of DNA
For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: a) the sequence of the complementary DNA strand
what is main difference for B-DNA，A-DNA and Z-DNA？（in biochemistry）
Name 2 differences in the structural features of DNA and RNA and indicate the relevance of each difference to the function/s of DNA and RNA. Number your answers.
Briefly explain (1) the structure characteristics of DNA, (2) why different DNA molecules (i.e., with different sequences) could adopt the same B-form double helical structure, and (3) how certain proteins could recognize the specific sequences with the common B-form DNA.