5.State the contribution of the following scientists to the understanding of DNA structure: a)Erwin Chagaff b)James Watson c)Francis Crick

Q: Next generation sequencing using Illumina platforms identifies individual bases in a DNA fragment…

A: The following steps are involved in next generation sequencing: 1) First the DNA sequencing…

Q: "supercoiling" mean in the context of DNA structure? Define or explain the difference between…

A: DNA is made up of various nucleotides that store genetic information in it. DNA is packed into a…

Q: 1. What does PCR allow you to do with DNA?

A: The separated and identified PCR results are then used to characterize the STR region under…

Q: 2. If one strand of a DNA molecule has the base sequence5′-AGCATTAAGCT-3′, what is the base sequence…

A: The deoxyribonucleic acid (DNA) is a hereditary material that is found in almost all living…

Q: 1. How do you determine the purity of DNA? If a DNA has 1.8 A260/A280 ratio, what does it mean? What…

A: DNA is a molecule made up of two polynucleotide chains that form a double helix and carry genetic…

Q: ing the gel picture of the DNA ladder, show where your digestion of the paper cutting model showing…

A: DNA is a double stranded biomolecule. The DNA is usually digested by endonucleases and exonucleases…

Q: 1. If 30% of DNA is Adenine, what percent is Thymine?

A: DNA ka double helical structure that consists of sugar phosphate and bases. the sugar that is…

Q: 3. The Watson-Crick model pictures DNA as as the step. spiral staircase with the as the handrails…

A: DNA has a double-stranded structure in which two strands run in an anti-parallel direction. DNA…

Q: 7. What is the base sequence, specified in the 5' to 3' direction, for a segment of newly formed DNA…

A: The genetic material in most organism is double stranded DNA with the two strands running in…

Q: 1) What DNA base sequence is complementary to the following DNA sequence? TAGCGTGCATGGTGCTTAAC 2)…

A: Introduction: DNA stands for 'deoxyribonucleic acid' and it is the hereditary material in humans and…

Q: 5'- What will be the Sanger products of the DNA with base sequence ACGTCGACTCCGGTC-3'

A: DNA sequencing is the biochemical method used for determining the order of nucleotide bases, A, G,…

Q: Describe 5 examples of biological processes that can cause DNA supercoil?

A: Supercoiling This process takes place to relieve the helical stress in the molecule through twisting…

Q: 17. Describe the Watson and Crick model of DNA structure.

A: DNA is the carrier of the genetic information from generation to generation.

Q: Discuss the reasons proteins were generally favored over DNA as the genetic material before 1940.…

A: DNA and RNA are considered as a genetic material. DNA is inherited or transferred from parents to…

Q: 5. What is complementary base pairing?

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 1) A molecular biologist creates a form of RNA polymerase that has the same proofreading ability as…

A: A polymerase is an enzyme that helps to synthesizes long chains of polymers or nucleic acids. It…

Q: 1. How does the DNA structure reflect its functions?  2. What are the important features of the DNA…

A: The DNA molecule is made up of two strands that form a double helix shape as they coil around one…

Q: what is the significance of famous dna structure experiment?

A: The Hershey–Chase experiments were a series of experiments conducted in 1952 by Alfred Hershey and…

Q: 1. During the replication of a DNA molecule, separation or "unzipping" of the DNA molecule will…

A: DNA, is generally a  give a short term for deoxyribonucleic acid, is the molecule which contains the…

Q: 1. Which pieces of DNA are the most informative? Why?

A: as per our company guidelines we are supposed to answer only first 1question. Kindly repost other…

Q: 19.Examine the following DNA sequence and determine what type of mutation, if any, produced the…

A: Mutations are certain modifications takes place in the sequence in DNA . Mutations is classified as…

Q: 8 How natural processes can change the information stored in DNA?

A: Genetic information is stored in the chemical structure of DNA molecule. DNA molecule contains two…

Q: 2. Describe what is meant be the antiparallel arrangement of DNA.

A: The double helix model of DNA was the famous and most valuable discovery by Watson and Crick. This…

Q: 6. Assume that you are working at a biotechnology company and you are assigned to a project in which…

A: Protein purification is a set of procedures for isolating a single or a few proteins from a…

Q: 2. How does the universality of the genetic code make the recombinant DNA technology possible?

A: A nucleic acid is a linear polymer of nucleotides that is a component of the cell's information…

Q: 4b) Chargaff was the first person to isolate large strands of genomic DNA, rather than small…

A: DNA is the hereditary material in humans and almost all other organisms. Nearly every cell in a…

Q: 7. Which of the following best characterizes the events that occur at an origin of DNA replication?…

A: Replication is the process of duplication of individual strands of a double stranded DNA.  The…

Q: Which statement below explains the trick in sanger sequencing that produces fluorescently labeled…

A: DNA sequencing  Sequencing of DNA is a method to know the order of nucleotide bases in a DNA strand.

Q: 1. a) What does DNA stand for? b)What is the name of the DNA structure?

A: DNA is self replicating by molecules that are present in chromosome and carry in genetic…

Q: 19. You have reasonably short, typical, double stranded DNA sequence. Basically how many proteins…

A: DNA's molecular structure is referred described as a "double helix." Two connected strands that…

Q: 2.) It was Rosalind Franklin that helped Watson and Crick realize that the sugar-phosphate backbone…

A: Building blocks of DNA that had been known for many years yet the DNA structure was not known the…

Q: 5. Name the five nitrogenous bases in the table below, and put an X in the correct column for each…

A: A nitrogen base, sugar molecule, and phosphate groups make a nucleotide. A nucleotide is a…

Q: 1. What is the purpose of recombinant DNA technology?

A: Since you have posted multiple questions, we will do one question for you. If you need any specific…

Q: 1. Where is the cleavable blocker located on the modified nucleotides used in Illumina sequencing?

A: Illumina sequencing is developed by Solexa and was subsequently acquired by Illumina.  This…

Q: 1) Develop an analogy for the processes researchers use to make changes to DNA. In analogy, explain…

A: Nucleic acids are macromolecules composed of nucleotides (sugar, phosphate, and nitrogen base) bound…

Q: 3. Give the different hydrolytic products of : a. DNA b. RNA

A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…

Q: How many hydrogen bonds are present in a DNA double helix fragment consisting of the following…

A: Deoxy ribonucleic acid is the double-stranded hereditary material that consists of sugar,…

Q: List the complementary non-coding DNA sequence. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .

A: DNA consist of a double-helical structure where one strand is called a sense strand or non-coding…

Q: What is the purpose of adding of (a) warm salt water, (b) detergent, and (c) alcohol on the…

A: Extraction of DNA from a banana involves mashing, filtration, precipitation and extraction.

Q: 1. The following gel was produced in manual DNA sequencing. What would the unknown DNA template be…

A: The method of determining the nucleic acid sequence – the order of nucleotides in DNA – is known as…

Q: Explain the concept of central dogma of biology

A: The ultimate goal of all living beings is to pass on their genetic information. This genetic…

Q: 1. Which of the following are generated due to the twisting of dsDNA?  a. Hydrophobic bonds b. Van…

A: DNA acts as genetic material in most organisms. DNA is a double-helical structure in which two…

Q: 7. Given what is known about DNA structure, which of the following general shapes might be found?…

A: DNA is the helical structure of two antiparallel polynucleotide. Both the polynucleotides are…

Q: 2. A. Proteins stick to DNA through hydrogen bonds. Draw your choice of a correctly hydrogen bonded…

A: Hydrogen bonds are one most most frequently seen chemical bonds in biomolecules , whether it be in…

Q: 7. Discuss the modes of actions by which the following three compounds disrupt DNA- associated…

A: Whether its a cancer cell trying to multiply inorder to generate more cancer cell or a pathogen…

Q: 3. The Watson-Crick model pictures DNA as a as the step. spiral staircase with the as the handrails…

A: The double helical structure of DNA was first proposed by James Watson and Francis Crick. According…

Q: Describe four differences between A and B forms of DNA

A: DNA is composed of four different types of nucleotides attached together via phosphodiester bonds.…

Q: 5. In the late 1950s, Meselson and Stahl grew bacteria in a medium containing "heavy" nitrogen (15N)…

A: DNA is the genetic material in most living organisms and is the information hub of the cell. It…

Q: Who are the scientists that proved DNA is the transferrable genetic material and Discuss how they…

A: Introduction  DNA was never thought to be the genetic material as it was so inert and lacking…