4. DNA dissolves in water, but not in ethanol. Explain what happened when the ice cold ethanol came in contact with the cell extract during your extraction. If the ethanol was not ice cold, how would this have affected your collection? 5. What are the potential reasons for extracting DNA from a cell? a) b)

4. DNA dissolves in water, but not in ethanol. Explain what happened when the ice cold ethanol came in contact with the cell extract during your extraction. If the ethanol was not ice cold, how would this have affected your collection? 5. What are the potential reasons for extracting DNA from a cell? a) b)

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter12: Dna: The Carrier Of Genetic Information

Section: Chapter Questions

Problem 9TYU: Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break...

See similar textbooks

Similar questions

1. What is the purpose of adding of (a) warm salt water, (b) detergent, and (c) alcohol on the experiment of the extraction of DNA from a banana?
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
1. How may recombinant DNA molecules be introduced into human cells? a. by splicing the needed genes into a mammalian chromosome using restriction enzymes. b. by adding plasmids to the mammalian cells. c. by using engineered viruses as vectors. d. by using a gene gun. 2. If someone is accused of a crime, investigators can collect his or her DNA to compare the DNA of the cells found at the crime scene. To collect human DNA, investigators often swab the inside of person’s cheek. Just a few human cheek cells contain enough material to perform PCR. In a cell, the nucleus and mitochondria contain DNA that is the starting material for PCR. Identify the 4 components needed to start a PCR reaction (equipment not included)
1. Discuss why it is critical to add TE Buffer as the final solution to isolate the concentrated DNA. 2. Using a centrifuge, explain the rationale for separating various cellular components 3. What is the relevance of DNA being frequently referred to as the "blueprint for life?"
When Griffith injected mice with a combination of live rough-strain and heat-killed smooth-strain pneumococci, he discovered that (a) the mice were unharmed (b) the dead mice contained living rough-strain bacteria (c) the dead mice contained living smooth-strain bacteria (d) DNA had been transferred from the smooth-strain bacteria to the mice (e) DNA had been transferred from the rough-strain bacteria to the smooth-strain bacteria
Topoisomerases (a) synthesize DNA (b) synthesize RNA primers (c) join Okazaki fragments (d) break and rejoin DNA to reduce torsional strain (e) prevent single DNA strands from joining to form a double helix
Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to examine the sample, he increased its quantity by cycling the sample through the polymerase chain reaction. He estimated that there were 50,000 copies of the DNA in his original sample. Derive a simple formula and calculate the number of copies he will have after15 cycles of the PCR.
Discuss how enzymes proofread and repair errors in DNA.
The statement DNA replicates by a semiconservative mechanism means that (a) only one DNA strand is copied (b) first one DNA strand is copied and then the other strand is copied (c) the two strands of a double helix have identical base sequences (d) some portions of a single DNA strand are old and other portions are newly synthesized (e) each double helix consists of one old and one newly synthesized strand
If DNA of a particular species was analyzed and it was found that it contains 27 percent A, what would be the percentage of C? 27 percent 30 percent 23 percent 54 percent
What information and materials are needed to amplify region of DNA using PCR?
Which of the following statements about DNA replication is false? a. Synthesis of the new DNA strand is from 39 to 59. b. Synthesis of the new DNA strand is from 59 to 39. c. DNA unwinds, primase adds RNA primer, and DNApolymerases synthesize the new strand and remove the RNAprimer. d. Many initiation points exist in each eukaryotic chromosome. e. Okazaki fragments are synthesized in the opposite directionfrom the direction in which the replication fork moves.