Answered: Discuss how mutations in the 5’ splice…

Name: Discuss how mutations in the 5’ splice site, 3’ splice site or branch
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: Discuss how mutations in the 5’ splice site, 3’ splice site or branch point of an intron maydisrupt RNA splicing and what the effect may be on the phenotype.

Science

Biology

Discuss how mutations in the 5’ splice site, 3’ splice site or branch point of an intron may disrupt RNA splicing and what the effect may be on the phenotype.

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section13.5: Mutations

Problem 12LO: Give examples of the different classes of mutations that affect the base sequence of DNA in protein...

See similar textbooks

Similar questions

Explain how each of the following processes complicates the concept of colinearity. Q. Trans-splicing
Explain the different events under post transcriptional modification. A. 5'capping B. Polyadenylation C. RNA splicing
Describe the process of RNA splicing, including the roles of the spliceosome and self-splicing RNA molecules.
There is a situation in which a gene has five exons. Please draw four possible mature products of the gene if there is alternative splicing.
Identify alternative splicing variants of this transcript, NOT including the original unspliced variant. (Select all that apply.) a) Exon 1, Exon 3, Exon 4 b) Exon 1 and Exon 4 c) Exon 1, Exon 2, Exon 4 d) Exon 2, Exon 3, Exon 4 e)Exon 1, Exon 2, Exon 3, Exon 4
Explain how the pausing of the ribosome in the presence or absence of tryptophan affects the formation of a terminator (3–4) stem-loop, and describe how this affects transcription.
Discuss the advantages, in terms of protein structure and evolution, that result from alternative mRNA splicing.
Give examples of the different classes of mutations that affect the base sequence of DNA in protein encoding genes and explain the effects that each has on the polypeptide produced.
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
Below is the RNA sequence of a primary transcript. Underline (or highlight) each intron, and then clearly show a point mutation that would prevent intron two from being spliced out. Assume each intron is spliced using the 5' and 3' splice sites that are closest to each other. GCUACGACGAUGGAUGCGACUCGUUCACAGACUGAGGCUUGAUUGUCAGAACGCGCUGGAUGAUAGCUUGAUCGAUAAUAAACGACUACGAUCGCUCGAUCGAACGACCG
Knowing that RNA splicing removes unwanted sequences from the primary transcript, briefly describe this process.
A gene contains eight sites where alternativesplicing is possible. Assuming that the splicing pattern at each site is independent of that at all other sites, how many splicing products are possible?