Q: It is intended to toughen poly(methyl methacrylate) (PMMA) by the addition of particles of rubbery…
A: No, I would not expect the material to retain its clarity. This is because of reasons written in 2…
Q: edral site). Determine by how much the diameter of the C atom in y-Fe is overs ct to the gap of the…
A: An interstitial atom is one which occupies a site in crystal structure and normally not…
Q: Which are true for polarography? Polarography is amperometry conducted with a dropping Hg electrode.…
A: Option C is true Statement 4 is true as we use the dropping mercury electrode as the working…
Q: Please help complete the sub-parts
A: The given answers for #(a), #(b) and #(c) are right.
Q: Calculate the melting temperature (TM) for the GFP primer- CATGGTCCTGCTGGAGTTCGTG (please give…
A: In DNA sequencing, A compliments T whereas G compliments C ( Chargaff Rule). The formula for…
Q: Discuss detail account on fol soft ionization techniques? a. Matrix Assisted Laser Desorption…
A: a. Matrix Assisted Laser Desorption Ionization (MALDI) Used mainly for large biomolecules (Peptides…
Q: Assign the following as Ror S.
A:
Q: Give some of the application of Coloumetry, Potentiometey, Electrogravimetry and Voltammetry in…
A:
Q: Outline the possible reaction pathways with proper mechanism for the formation of Nylon 6 from…
A: Polymerization: It is a chemical process when a monomer (single unit) combined through various…
Q: Why magnetic moment of Fe(II) is higher than Mn(II). Discuss in terms of orbital contribution . (…
A:
Q: what will happen to the rate constant if the concentrat -fold.
A: As we know in elementary reaction order of reaction is sum of stoichometric coefficients of…
Q: Generally, anion exchange resins are negatively charged. Is it true or fasle?
A: This statement is false.
Q: What is cross linking, give how does it effect recycling ability and strength of a polymer,
A: This is a question from polymer chemistry.
Q: Calculate the theoretical yield of the "free radical polymerization of styrene reaction": Amount of…
A: From the given data - Mass of styrene used in the reaction = (Volume)(density) = (2.5 mL)(0.909…
Q: Show that (35), - (25) = ( ) - ( ), ан ар aG ар
A:
Q: and sheets of thermoplastic polymers. Elucidate the po giving TWO (2) suitable examples. Polymers…
A: polymers used in the production of films and sheets: Polyethylene, poly propylene and polyester.…
Q: Structure
A:
Q: Q1) Describe in detail Process of Adsorption, its types and Industrial application.
A: Adsorption is the accumulation of the molecules at the surface of the material. It is surface…
Q: what is the ir ip. relationshi
A: Given compounds are enantiomers. These compounds are non superimposable mirror images of each other…
Q: The IR and NMR spectra of the material whose structure formula is C16H22O4 are given below.To this…
A: The ester functional group is identified by the presence of the RCOOR' group, where R and R' are…
Q: Questions 27 to 31 concern the following organic compounds (A) HOOCCHCHCOOH (B) C:lICHOHCH (C)…
A: 31. The reaction of ammonium cuprous chloride with terminal alkynes gives a red-brown ppt. The…
Q: Show by a series of equations (with structures) the first stage of the Edman method applied to a…
A: Edman degradation given by Pehr Edman, it is a process of purifying protein by sequentially removing…
Q: A solution of tryptophan has an absorbance of 0.64 at 280 nm. Given with of 6.04 x 103 M solution of…
A: Given information: Absorbance (A) = 0.64 Concentration (c) = 6.04×103 M Length (l) = 0.5 cm
Q: Describe the injection moulding process and distinguish between the injection moulding of TP and TS…
A: Injection moulding process is a method in which plastic materials are injected and are heated or…
Q: Analyzing Polymers (Gray Band of Goggles) Interpretation:
A: A question based on IR spectroscopy that is to be accomplished.
Q: Give a clear explanation handwritten answer...please give explained answer
A: Given elements are - As, Fr, N, Si, Sb Electronegativitiy is the tendency to attract electrons…
Q: (P.Ç.1.2) Calculate the polydispersity index of a polymer than consisting of following molecular…
A:
Q: Br CuBr/PMDETA Δ For the atom transfer radical polymerization of the following monomer, i.) provide…
A: (i) We have to draw the structure of a 2-mer with an active chain end in the dormant form.
Q: what is pseudo order treatment
A: Pseudo is Latin word which means ‘fake’. A Pseudo order reaction can be defined as a bimolecular…
Q: i) Explain why polypropylene is mainly produced by the coordination polymerization, but not by the…
A: The solution of the question is given below:
Q: How can X-ray Diffraction analysis be used in structure and mechanism elucidation? Explain your…
A: X-Ray Diffraction is a non-destructive test method used to analyse the structure of crystalline…
Q: please explain the solid solution to me completely and comprehensively. preferably with shape and…
A: Solid solution, mixture of two crystalline solids that coexist as a new crystalline solid, or…
Q: Write the significance of poly dispersity index; also calculate the number-average molecular weight,…
A: There some small molecules while some are very long molecules, having a molecular weight in…
Q: Electrophoresis of a mixture of lysine, histidine, and cysteine is carried out at pH 7.64. Describe…
A: The pH at which amino acid is neutral, or in other words have both negative and positive charge, is…
Q: Deepak has a polymer containing alternate Π-bonds and doped with oxidizing or reducing agent?…
A: The polymer is a substance that contains several repeating units and forms a high molecular weight…
Q: Based upon a study of the iterature, discuss Ginberg's polarization then as it applies to the…
A: The ability of certain ligands to increase the rate of ligand substitution when positioned trans to…
Q: The measured optical rotation of polyglutamic acid as a function of wavelength (2) can be fitted by…
A:
Q: With reference to the polymerisation mechanisms explain why the polydispersities of the two samples…
A: Polydispersity index is defined as the ratio of weight average molecular mass and number average…
Q: 7. What is the Mw/Mn value for a free radical polymerization if the termination is mainly by…
A: The process of formation of large molecule that is polymer from small repeating units (known as…
Q: Plywood and particle board are often glued with cheap, waterproof urea-formaldehyde resins. Two to…
A: The structure of Urea formaldehyde is The resin can be prepared by reaction of urea with…
Q: The following table lists molecular weight data for a polypropylene material. compute the following.…
A: The table for the calculation of number average molecular weight is given below.
Q: Polyethylene glycol, or Carbowax®, is widely used as a binder, thickening agent, and packaging…
A: Polyethylene glycol (PEG) is a polyethylene resin derived from petroleum for many uses, from…
Q: you are using MMA with two initiators N,N-Diisopropylethylamine and Ethyl α-bromoisobutyrate to…
A:
Q: Consider the following series of poly(phenylene oxide) polymers A–D, and their glass transition…
A: The estimation of Tg depends on the versatility of the polymer chain - the more stable the chain,…
Q: Write the Structure Activity Relationship (SAR) of Losartan ? Please write at your own words.
A: Losartan Is useful to prevent heart attack. It is a angiotensin II Receptor blocker.
Q: a. The structure of a standard C4 group chemically bonded to a silica surface through a silyl ether…
A: SOLUTION: Step 1: The most commonly used column in silica based reverse stationary phase is…
Q: (c)Explain why glass cells are not used in, UV-spectroscopy.
A: Uv or ultraviolet spectroscopy is a kind of absorption spectroscopy where light of wavelength…
Q: The K2S208 product may be contaminated with K2SO4 or KHSO4. Suggest a method for determining the…
A: PREPARATION OF K2S2O8: The preparation reaction of potassium peroxydisulfate is takes place with the…
Q: what the mechanism of action of EDTA in the study, advantages and results obtained.
A:
Step by step
Solved in 4 steps with 2 images
- Outline some methods for obtaining ultra-high orientation in polymers (e.g. Kevlar).Give some idea about -: "Electrospun composite fibers for biomedical applications" Dont try to reject it is problm from polymer chemistry , if possible use some pic to explain thanks much in advanceDiscuss the suitable initiator to start an addition polymerization. Define what is auto-acceleration, what causes this effect and how to minimize this effect. Briefly discuss emulsion and suspension polymerization techniques.
- Sketch and label the expected stress-strain curves at room temperature for lightly cross-linked poly(butadiene) and reinforced poly(methyl methacrylate). Compare the behaviour of each specimen in terms of modulus and toughness.Write chemical reactions illustrating a polymerization mechanism involving the monomers listed below. Would the reactions be considered step growth or chain growth? Explain and supportDo the conclusion to the production of vinyl polymers using bulk methods.
- What is charge transfer mechanism in N type doped polyaceteylene? Explain!Deepak has a polymer containing alternate Π-bonds and doped with oxidizing or reducing agent? Explain the type of polymer and write the properties of that polymer? What are application of such polymers?Question 1 a. Briefly describe what is thermoplastic, thermoset plastic and elastomer. Give examples to clarify your answers. b. Briefly discuss the effect of thermodynamic on polymerization. c. What are important factors influencing the properties of polymers? Question 2 a. Discuss the suitable initiator to start an addition polymerization. b. Define what is auto-acceleration, what causes this effect and how to minimize this effect. c. Briefly discuss emulsion and suspension polymerization techniques. Question 3 a. Discuss the differences between condensation and addition polymerization. b. What requirement should be provided to achieve high yield and high molecular weight of polymer by condensation reaction? c. What is interfacial polymerization? Question 4 a. Describe biopolymer and synthetic polymer. Give examples to support your answer b. Briefly discuss the classification of polymers. c. Why polymers are widely used in our daily life? Question 5 a. Describe TWO (2) important…