Answered: 6. Please describe the events that may…

Science

Biochemistry

6. Please describe the events that may result in a mature protein not having methionine as the N-terminal amino acid.

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 5SQ: The main function of a DNA molecule is to ________ . a. store heritable information b. carry a...

See similar textbooks

Related questions

Q: 8 What are the three components of anucleotide?

A: Nucleosides are a combination of a nitrogen base with pentose sugar. The nitrogen base combines with…

Q: 7. A proteolytic enzyme has the following action:

A: Proteolytic enzymes are also known as proteases. Body has various proteolytic enzymes like pepsin,…

Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: The genetic code is which allows DNA and RNA sequences to be decoded into the amino acids of a…

Q: 7) Describe in detail the mechanism by which the major spliceosome removes introns from pre-mRNA…

A: Spliceosome is a complex small nuclear RNA protein molecule also called snRNA that helps to remove…

Q: 5. A DNA sequence of "ACG" will code for the amino acid - (LS1- 1) * Second mRNA base C. UUU Phe UUC…

A: Gene expression refers to the complex, highly-regulated biological process, which involves the…

Q: 1. Assume that the ribosome has just catalyzed the formation of a peptide bond, but the ribosome has…

A: Translation of the nucleotide bases sequence in the mRNA to the amino acids results in the formation…

Q: 1. a)how is it possible for such drugs to selectively kill bacterial cells and not our own cells?…

A: The chemicals or the drugs that are employed to kill bacteria are termed antibiotics. The regulation…

Q: 4. Compare the DNA sequences of individuals with Alzheimer's disease and their family members. Two…

A: The amyloid beta precursor protein (APP) is coded by the APP gene that is located on the chromosome…

Q: 8. Explain the role of post-translational modifications of protein molecules: the formation of…

A: By covalently adding functional groups or proteins, proteolytic cleavage of regulatory subunits, or…

Q: Explain why do eukaryotic mRNAs have to be “processed” whereas most prokaryotic RNAs do not?

A: Ribosomal and transfer RNAs are processed in both prokaryotes and eukaryotes. The processing of…

Q: List the amino acid sequence of the protein coded for.…

A: The translation is the process of synthesis of amino acids from the mRNA. During the translation…

Q: 7. Predict the bases that will pair with the following bases to form the complementary messenger…

A: There are basically 4 types of nitrogenous bases ATGC and in RNA thymine is replaced with Uracil.

Q: 1. Based on the results obtained give the differences between the hydrolyzed and unhydrolyzed RNA.

A: The monomeric units of nucleic acids are called nucleotides. Nucleotides are generally…

Q: 3. A missense mutation results in the presence of a different amino acid than was encoded by the…

A: Sickle cell anaemia is an autosomal recessive disorder.

Q: Please describe the events that may result in a mature protein not having methionine as the…

A: Translation process of formation of a sequence of amino acid using messenger RNA as a template.

Q: All of the following occur when the amino acids of two tRNA molecules are joined, except. a. The…

A: DNA replication, transcription, and translation are the molecular processes that are responsible for…

Q: 7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide…

A: DNA to mRNA is transcription and mRNA to protein is translation.

Q: 15. Adenine (A) pairs with Guanine (G) pairs with

A: asked for 15 so answered 15 th question. DNA is the nucleic acids present in the organisms. DNA is…

Q: 3’ G G A U A C G U C A C C G G U A U A A G G U U U C G U A U C G 5’ If the RNA synthesized above is…

A: Codon It is the three consecutive sequence of a mRNA that code for amino acid.

Q: 8. A peptide hormone consists of nine amino acids in this sequence: arg-pro-pro-gly-phe-…

A: In this question, we are given a peptide sequence which is arg-pro-pro-gly-phe-ser-pro-phe-arg. We…

Q: 1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC…

A: The genetic code is a set of three-letter combinations of nucleotides that corresponds to a specific…

Q: 7. Give all the possible Anti-codons for the amino acids listed below. Histidine (His) Isoleucine…

A: Codons is a sequence of three nucleotides that corresponds with a specific amino acid or stop signal…

Q: 1) A segment of DNA has the following sequence of bases ...5'-ATGCAATGATATTGAAGCTTA -3'... a.) what…

A: Transcription is defined as the synthesis of mature mRNA from antisense DNA template. Translation…

Q: Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic…

A: DISCLAIMER: Since you have asked multiple questions, we have solved the first question for you. If…

Q: 2a. The DNA is mutated on the 4th base pair to the following: DNA:3'TAC GAT GAG GTC 5' АTG CТА СТС…

A: No, this mutation might not change the way in which the protein functions. In this mutation the…

Q: 5. There is more than one codon and tRNA for most amino acids. The L-shaped molecule binds a…

A: Charged tRNA match an mRNA codon with the amino acid it codes. tRNA brings amino acids to…

Q: 5. The lacl gene is only transcribed when both glucose and lactose are present. True or False.

A: Gene regulation at the level of transcription in bacteria is achieved by the operon model. Operon…

Q: iii. Mutant C has had the first 5 base pairs deleted (position 1-5). Does this mutation change the…

A: Promoter sequence is present in the DNA at the upstream of regulatory gene.

Q: 2. Describe the process that is occurring in this image protein nibosome

A: The proteins are the final product of a gene that perform all the functions within the cell.…

Q: 6. Which of the following amino acid does not include post-translational modification? a.…

A: Post translational modification is a covalent and enzymatic modification which occurs after the…

Q: Write out the protein sequence (the amino acids, in order) encoded by the mRNA sequence:…

A: Amino acid for AUG is Methionine Amino acid for CGA is Arginine Amino acid for CCU is Proline Amino…

Q: 1. What happen to the mutated sequence in the coding region of MT-ATP6 in Leigh's syndrome. Does it…

A: Leigh's syndrome is a rare neurogenetic disorder that affects the central nervous system. The…

Q: What determines the affinity of a glycan for a GBP?

A: Glycans and glycan-binding protein interaction are a major way of understanding the structure of…

Q: 2. Decode the hidden message from the polypeptide coded by the DNA sequence below. Express the amino…

A: The given sequence can be read by combining sets of three nucleotides per amino acids.

Q: 1. TRUE OR FALSE a) Eukaryotic mRNA contains the message from the DNA for the synthesis of one…

A: In polycistronic mRNA the mRNA can encode several proteins and is characteristic of many bacterial…

Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: The process of translating an mRNA strand into an amino acid sequence at the time of protein…

Q: 9. What is the purpose of the following? a) spliceosomes b) RNA polymerase c) Protein release…

A: The central dogma of molecular biology involves the processes of transcription and translation that…

Q: 5. A DNA sequence of "ACG" will code for the amino acid (LS1- 1) * Second mRNA base U UUU Phe UCU…

A: Each codon in mRNA is made up of three nucleotides, and each codon indicates a certain amino acid…

Q: 1. Using the genetic code, determine the sequence of amino acids encoded by the mRNA codocn sequence…

Q: The codon AUG on the mRNA codes for which amino acid (give the 3-letter abbreviation)? _______…

A: The translation is the process by which protein or polypeptide chain is produced from mRNA. The mRNA…

Q: 30 A DNA sequence encoding a five-amino acid polypeptide is given below.…

A: Protein molecules are those molecules that are made up of chains amino acids in a specific order.…

Q: 6. Shown below are the amino acid sequences of the wild-type and three mutant forms of a protein.…

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If…

Q: 7. Guanidinium group is associated with: a. Tyrosine b. Arginine c. Histidine d. Lysine e.…

A: Amino acids are building blocks of protein and amino acids are composed of an amino group, carboxyl…

Q: State if/how Remedios' mutation changes the amino acid sequence and describe the effect that change…

A: CAT codes for HISTIDINE. CGT codes for ARGININE Since the mutation has changed the final amino acid…

Q: Write a DNA sequence that would encode the amino acid sequence…

A: In this question, we are given an amino acid sequence for which we have to determine DNA sequence.…

Q: 1) what is the net charge of the amino acid leucine of it is on the C-terminus end and why? 2) if…

A: Proteins are among the most numerous organic molecules in biological systems, and their structure…

Q: How is a protein made inside the cell, from the very start until when it is shaped and packaged?

A: Proteins are an important biomolecule made up of long chains of amino acids. They are important for…

Q: 1. The enzyme activity that forms peptide bonds on the ribosome is called peptidyl transferase.…

A: Answer:- The process in which the peptide bonds formation occur in between the ribosome called…

Q: 2. What is the minimum number of single nucleotide substitutions that would be necessary for each of…

A: For amino acid production the DNA is transcribed to RNA and RNA is translated to amino acid…

Question

6. Please describe the events that may result in a mature protein not having methionine as
the N-terminal amino acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

6. Please describe the events that may result in a mature protein not having methionine asthe N-terminal amino acid.
3. List the amino acid sequence of the protein coded for. CCUGCAGUAUGAAACGCCUGGUAGAAGGUGGGAAGUGGUGCGCCC . . .
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
1. What is the length in AA’s of the LilP protein? Assume fMet is NOT CLEAVED. 2. Write out the sequence of the polypeptide in AA: use the three letter notation, e.g. Met-Ser-Pro-
1. Use the info of this molecule as well as the attached addendum to demonstrate the flow of genetic information to protein sequence as described by the so-called “Central Dogma” . Clearly indicate the direction of your polynucleotide strands and peptide/protein. ATG GCA TGC AAT AGC TCA TGC 2. What would happen to the amino acid sequence if the underlined nucleotide (C) would change to an A?
1. What are congenital disorders of glycosylation (CDGs)?
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
1. Identify the name of the correct amino acid that corresponds to the correct tRNA codon and mRNA codon. State the process used to convert to mRNA and tRNA.
1. Discuss the difference between intron and Exon
30 A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT… …TGCCGTTCTAGGGTGGGATTAGTCTGGCATGGTAAGTGGAGGA… b)Give the sequence and polarity of the mRNA encoding the polypeptide.
1. Explain why do eukaryotic mRNAs have to be “processed” whereas most prokaryotic RNAs do not?
The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy