DNA from actively dividing bacteria was isolated and examined to find two groups of DNA. One group DNA included very large molecules (thousands or even millions of nucleotides long), and the other included short stretches of DNA (several hundred to a few thousand nucleotides in length). What was the researcher actually seeing in these two groups?Group of answer choicesmRNA molecules and siRNA moleculesOkazaki fragments and RNA primersleading strands and Okazaki fragmentsleading strands and RNA primers

DNA is made up of nucleotides. Each nucleotide is made up of a nitrogenous base, phosphate group and…

DNA from actively dividing bacteria was isolated and examined to find two groups of DNA. One group DNA included very large molecules (thousands or even millions of nucleotides long), and the other included short stretches of DNA (several hundred to a few thousand nucleotides in

DNA from actively dividing bacteria was isolated and examined to find two groups of DNA. One group DNA included very large molecules (thousands or even millions of nucleotides long), and the other included short stretches of DNA (several hundred to a few thousand nucleotides in

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Related questions

Q: Some white blood cells have lobed nuclei. Why

A: Ans- Unlike red blood cells, white blood cells (leukocytes) are nucleated and motile. They are…

Q: Suggest how the weak points of the Molisch test for carbohydrates can be strengthened by comparing…

A: Introduction Carbohydrates, often known as sugar molecules, are sugar molecules. Carbohydrates are…

Q: John and Jane each have a sibling with cystic fibrosis, but neither John nor Jane nor any of their…

A: Introduction Cystic fibrosis (CF) is a genetic condition that affects the digestive system, lungs,…

Q: Shown below is a list of statements. Choose ALL the statements below that is/are TRUE for meiosis.…

A: The indirect process of cell division in which the chromosomes of parent cells divide once, but…

Q: why is RNA important in a physiology standpoint, and why is it important to know about this for…

A: RNA is Ribose nucleic acid. Its main building block is a nucleotide which is made up of a ribose…

Q: What is the function of the axon? to receive information and information into the cell body to store…

A: The neuron is the functional unit of the nervous system. The neurons send and receive signals from…

Q: What are rabi crop and kharif crop

A: Agriculture is the most important part of the lifestyle. The crop production occurs according to the…

Q: Identify the type of inheritance from the given example - Piebald (white) spotting in cats: Cats…

A: Introduction Heritability of characteristics between generations is an important aspect of…

Q: How might an understanding of the method by which gonorrhea is evolving resistance to certain…

A: Neisseria gonorrhoeae has developed resistance to a number of drugs already. They are penicillin,…

Q: 3. Label the following elements of the figure below: lysogenic phage, lysogenic cycle, lytic cycle,…

A: Introduction The lag phase, the log phase, the stationary phase, and the death phase are the four…

Q: A 50-year-old woman has diminished vibratory sensation on her right arm. Which of the following…

A: The brain and the spinal cord are the two main organs of the central nervous system. Spinal cord…

Q: a. What specific type of VECTOR will you use to perform your gene therapy? Please select from the…

A: Gene therapy is a treatment in which the genes that are missing or not normal in your cells are…

Q: Which of the following is NOT true of Innate Lymphoid Cells (ILCs)? A) Each ILC type responds to a…

A: Innate lymphoid cells are immune cells that mirror the phenotype and function of T cells. It…

Q: Please answer asap 15) Which molecular tag selects cargo proteins for lysosome. What molecular tag…

A: In many animal cells, a lysosome is a membrane-bound organelle. They're spherical vesicles with…

Q: Microbial products trigger macrophage activation. Match the receptor with the product that it binds.…

A: Toll like receptors (TLRs) are expressed in innate immunity cells. For example in macrophages and…

Q: Question 3 of 4 Match the following concepts to its specific indications. Match each item to a…

A: A homogenous mixture of a solute and solvent is called a solution. In solution, there are no…

Q: 61. Degradation of glycogen in muscle fails to supply significant amounts of blood glucose because…

A: 61. Degradation of glycogen in muscle fails to supply significant amounts of blood glucose because…

Q: Discuss the functional implications of the following structural changes in skin associated with…

A: As per the guidelines, we are supposed to answer only three sub-parts. Kindly repost the question…

Q: Match the endocrine glands numbered above with the functions listed below. ____ Releases a hormone…

A: Hormones are chemical messengers that are secreted directly into the blood, which carries them to…

Q: A) Additional origin of replication is included B) Chromosome is circular C) Enhancer region is…

A: Duplication of a stretch of DNA means that the same stretch is replicated and added to any reason of…

Q: Define homeostasis and explain its significance

A: Living things exhibit certain features that are not shown by nonliving things.

Q: A scientist experimentally knocks down Rac expression in the neural crest cells of developing…

A: NCC Neural crest cells are the multipotent cell that migrate through the embryo and later develop…

Q: Several substances found in nature or within living organisms themselves are essential to the life.…

A: Biochemical substances are the compounds found in living organisms. Cells and other structures of…

Q: 6 -5 .1 2 10 mm Frog Tadpole Transverse Section

Q: 1. Please identify the genotypes and phenotypes of offspring produced by the crossing of a rabbit…

A: (According to bartleby guidelines, we are required to answer only the first question in case of…

Q: Why do we need to eat protein-rich food and how does its structure relate to its function?

A: Proteins are huge, complex molecules that assume numerous basic roles in the body. They do the vast…

Q: True or False: Plasmids can ONLY be used in transforming bacterial cells.

A: Plasmid is small , circular double stranded DNA that is different from chromosomal DNA of cell.…

Q: From an evolutionary point of view, why can't we say that the human species is the most evolved?…

A: Evolution is the gradual modification of life forms through a period of time. This process takes…

Q: When Mendel crossed in his P generation a yellow-seeded and green-seeded pea plants, all the…

A: As in F1 generation,all the pea plants have yellow seeds.This means that In pea plants,allele for…

Q: Use the following figure to answer the question. юдо TO The pedigree in the figure shows the…

A: A pedigree chart is a graphic which depicts the incidence and emergence of phenotypes of a specific…

Q: Please discuss the difference between cancers caused by tumor viruses and cancers caused by…

A: Cancer is a disease where cells grow or divide uncontrolly.

Q: Why are we more aware of some sensationsthan others?

A: Living things respond to their surroundings by sensing the stimuli.

Q: Which of the following can explain the observation that two pureline mutants both showing identical…

A: Introduction :- The wild type allele is the one that codes for the trait that is most prevalent in a…

Q: What do you call a chromosome where its centromere is 3/4 from the end of the chromosome

A: Chromosomes are found in nucleus of cells and consist of DNA tightly bound into thread like…

Q: Selective destruction of a motoneurons in the spinal cord will have which of the following effects…

A: Introduction Muscles are soft tissues found in both animals and humans, it is the fibrous tissue in…

Q: 1.Name the vegetative propagules in the following: (i) Agave (ii) Bryophyllum

A: Reproduction is a process of formation of new organism from already existing organism . Reproduction…

Q: Describe the 3 processes of central dogma of molecular biology. Share your thoughts on their…

A: DNA and RNA form the basic genetic material of higher living organisms, including some viruses. DNA…

Q: 56. A 42-year-old man who has angina pectoris comes to a physician who is an investigator in a…

A: Angina pectoris A kind of pain in the chest which 8s develop due to insufficient flow of blood into…

Q: 25. Define the following hormones. Include the gland that releases them, the target gland, and one…

A: Testosterone: Testosterone is a sex hormone produced by the testicles in men. Testosterone levels…

Q: 2a) Which of the following statements about pyruvate oxidation IS TRUE? a. NADH is oxidized in the…

A: The answer to the above questions are given below -

Q: Explain counter-current flow and its importance to aquatic species

A: Fishes are the aquatic living organisms that live and survive in the waters. They possess…

Q: neurotoxin

A: Tetrodotoxin is the neurotoxin which acts as a sodium channel blocker . It binds to the voltage…

Q: In the human enzyme encoded by the DCXR gene, a mutation in the protein coding region of the DCXR…

A: Introduction Mutations are the alternation or changes that occur in the DNA. They are variations in…

Q: Explain why genetic disorders caused by recessive alleles of X-linked genes appear more frequently…

A: In humans and other mammals, biological sex is determined by a pair of sex chromosomes: XY in males…

Q: You are studying an autosome trait. There are two alleles, one showing complete dominance over the…

A: The Hardy-Weinberg's law essentially states that if no evolution is occurring, then an equilibrium…

Q: Match the granule with their function. ✓ Azurophilic Specific Gelatinase Secretory vesicles A.…

A: Granulocytes have specific granules structure in their cytoplasm. These cells are involved in innate…

Q: Paleontology: Catastrophism: Uniformitarianism: Inheritance of Acquired Characteristics: Theory…

A: Evolution and evolutionary studies Evolution is a continuous process of change for better survival.…

Q: According to current theories, people addicted to drugs still continue to use them because the…

A: the answer is false.…

Q: Which of the following is least related to the other items? Group of answer choices inducer…

A: The flow of genetic information in a biological system is explained by central dogma and it involves…

Q: Using the following word parts, build or complete medical terms from the definitions hem/o hyper-…

A: Using the following word parts, build or complete medical terms from the definitions below: Prefix…

Concept explainers

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.

Question

Group of answer choices

mRNA molecules and siRNA molecules

Okazaki fragments and RNA primers

leading strands and Okazaki fragments

leading strands and RNA primers

Definition Definition A complex molecule that makes up a fundamental unit of a DNA or RNA molecule. Nucleotides are composed of a sugar, a nitrogenous base, and a phosphoric acid.

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

What is 16S rRNA? Group of answer choices -The ribonucleotide component of the 50S ribosomal subunit -The larger of the ribosomal subunits -The smaller of the ribosomal subunits -The ribonucleotide component of the 30S ribosomal subunit Why is the 16S rRNA a good target for sequencing? Group of answer choices -16s rRNA is completely composed of conserved regions in most strains of bacteria -16s rRNA is composed completely of protein -16s rRNA is completely composed of variable regions in most strains of bacteria -16s rRNA contains both conserved regions and variable regions in different strains of bacteria What are the advantages of using 16S rRNA sequences? (more than one answer) Group of answer choices -16S rRNA sequences are relatively similar in close related species -16S rRNA is present in all bacterial species -16S rRNA sequencing is not affected by horizontal gene transferring -There is no direct correlation between amount of 16S rRNA copies and…
The following are DNA fragments containing a small gene. The top strand is the coding strand. Transcribe all 5 groups and translate. Group A 5’-GGCAATGGGTTTGTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTTTCAAAAATTAAG-5’ Group B 5’-GGCAATGGGTTTGTGAAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACTTTAAGATTTTCAAAAATTAAG-5’ Group C 5’-GGCAATGGGTTTGTGCAATTCTAAGAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTCTCAAAAATTAAG-5’ Group D 5’-GGCAATGGGTTTGTGCAATTCTAACAGTTTTTAATTC-3’ 3’-CCGTTACCCAAACACGTTAAGATTGTCAAAAATTAAG-5’ Group E 5’-GGCAATGGGTTTTGCAATTCTAAAAGTTTTTAATTC-3’ 3’-CCGTTACCCAAAACGTTAAGATTTTCAAAAATTAAG
The sequence of the coding strand of a bacterial gene is given below. The positions of the first nine bases are numbered for your convenience. A missense mutation was introduced at position seven where the C was changed to a T resulting a mutant gene. 123456789 5'- ATGGCCCGACCGCAACTTTTCCGAGCTCTGGTGTCTGCGCAGTGACC-3 a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write the DNA sequence of the mutant gene (Both DNA strands) c. Write the sequence of mRNA produced from the mutant gene d. Write the sequence of the mutant protein using the codon usage table provided in the end of this document.
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ Q. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism?
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
. An RNA polymerase is transcribing a segment of DNA that contains the following sequence: 5’-GTAACGGATC-3’ 3’-CATTGCCTAC-5’ If the polymerase transcribes this sequence from left-to-right, what will the sequence of the RNA be? What will the RNA sequence be if the polymerase transcribes right-to-left?
You obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base differences at three positions, all in different codons. One is a silent change, but the other two are missense changes (they encode new amino acids). How would you demonstrate that these changes are real mutations and not sequencing errors? (Assume that sequencing is about 99.9 percent accurate.)
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
You obtained the sequence of the frog gene X you amplified in Question #16 through a process called automated sequencing. In automated sequencing, you are given a printout of the sense strand of your DNA. The printout is shown below. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. Do these steps in the space below. The reading frame DNA sequence is: 2.The mRNA sequence is: The polypeptide sequence is:
In prokaryotes, a search for genes in a DNA sequenceinvolves scanning the DNA sequence for long openreading frames (that is, reading frames uninterruptedby stop codons). What problem can you see with thisapproach in eukaryotes?
You obtained the sequence of the frog gene X you amplified in Question #16 through a process called automated sequencing. In automated sequencing, you are given a printout of the sense strand of your DNA. The first thing you need to do is use the correct reading frame. Having done this, the next thing to do is to write out the mRNA sequence using this sense strand reading frame. The last thing to do is to translate the sequence. a.The reading frame DNA sequence is: b.The mRNA sequence is: c.The polypeptide sequence is: A disease in frogs which causes their tongue to fall out of their mouths is killing the frog population in LA County. You obtain a dead frog and isolate its gene Xf. When you sequence this mutated gene, you find that the last ‘G’ at the end of the first line of this sequence has been deleted (i.e. the G at position 86). In order to determine how this mutation changes the resulting polypeptide, write the mutated polypeptide sequence in the space below. What kind of…