You obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base differences at three positions, all in different codons. One is a silent change, but the other two are missense changes (they encode new amino acids). How would you demonstrate that these changes are real mutations and not sequencing errors? (Assume that sequencing is about 99.9 percent accurate.)

You obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base differences at three positions, all in different codons. One is a silent change, but the other two are missense changes (they encode new amino acids). How would you demonstrate that these changes are real mutations and not sequencing errors? (Assume that sequencing is about 99.9 percent accurate.)

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

In the actual experiment, the researchers used 149 sequences to buildtheir sequence logo, which is shown below. There is a stack at eachposition, even if short, because the sequence logo includes moredata. (a) Which three positions in this sequence logo have the mostpredictable bases? Name the most frequent base at each. (b) Whichfour positions have the least predictable bases? How can you tell?
. You obtain the DNA sequence of a mutant of a 2-kb genein which you are interested and it shows base differencesat three positions, all in different codons. One is a silentchange, but the other two are missense changes (they encode new amino acids). How would you demonstratethat these changes are real mutations and not sequencing errors? (Assume that sequencing is about 99.9 percent accurate.)
Which of the following mutational changes wouldyou predict to be the most deleterious to gene function?Explain your answers. 1. Insertion of a single nucleotide near the end of thecoding sequence.2. Removal of a single nucleotide near the beginningof the coding sequence.3. Deletion of three consecutive nucleotides in themiddle of the coding sequence.4. Substitution of one nucleotide for another in themiddle of the coding sequence.
You have sequenced the genome of the bacterium Salmonella typhimurium and find a protein that is 100 percent identical to a protein in the bacterium Escherichia coli. When you compare nucleotide sequences of the S. typhimurium and E. coli genes, you find that their nucleotide sequences are only 87 percent identical. How would you interpret the observations? Please make sure to select ALL correct answer options. Because genetic code is redundant, changes in the DNA nucleotide sequence can occur without change to its encoded protein. Due to the flexibility in the third positions of most codons, the DNA sequence can accumulate changes without affecting protein structure. Natural selection will eliminate many deleterious amino acid changes. This will reduce the rate of change in the amino acid sequence and lead to sequence conservation of the proteins. Protein sequences are expected to evolve and…
You were going to sequence a rice DNA fragment whose sequence was only know at one end, as shown below. 5’ AAACGATCGAGTCGCATCCAAAATCGATACCC—unknown region 3’ TTTGCTAGCTCTGCGTAGGTTTTAGCTATGGG—unknown region After several tries, you obtained a beautiful sequencing image as shown here: The worked out well partially because you had designed a primer for sequencing the unknown region according to the following guideline: Tm is 55 – 60°C. Ensures primer had a appropriate melting temperature for PCR ans sequencing. The GC content of the primer is the same as the genome/template (rice = 60%, human/Drosophila = 45-50%). A same nucleotide cannot be more than 2 in a row, e.g. CCC, GGGGG, AAA. The secondary structure of the primer must be none or weak. No primer dimers (The primer anneals to itself). 3’ end is the most important: it should not end in A, preferably ends in GG, GC, CG or CC This website can help you design the primer: http://www.oligoevaluator.com/OligoCalcServlet…
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
Human genomic libraries used for DNA sequencing are often made from fragments obtained by cleaving human DNA with Haeiii in such a way that the DNA is only partially digested; that is, not all the possible HaeIII sites have been cleaved. What is a possible reason for doing this?
(a) Why can there be multiple codons for an amino acid? Why would this have evolved? (b) What is the advantage of Illumina Next Generation Sequencing?
The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how much more or less frequently than random do they occur?
the one above: Replicate this sense strand to create a double-stranded DNA helix TGAGGATGAAACTCACACCGGGGCGCAGTTTGGCACTTAGATTCTTGTACACGACCTAGTATAACACAGTT Compare this mutated sense sequence given below to the original one given above and identify and classify all mutations that can be found in this new DNA sequence? TGAGCATGAAACTCACACCGGGGGCAGTTTCGCACTTAGGATTCTTGTACAGGACCTAGTATAACAAGTT 2. Using this mutated DNA strand, express it as a polypeptide by using the correct reading frame. When you get to the stop codon – you may write an “*” to denote the stop codon. 3. How many amino acids were changed in the mutated polypeptide?
What does the symbol “N” indicate (see the arrow)? Is this a problem for getting an accurate DNA sequence? The height of the peak in the figure is an indication of the quality of the data, with a high peak correlated with a low error in “base-calling” of perhaps 1 error in 10,000 bases. Is this generally a high-quality DNA sequence for determining the true DNA sequence of the gene studied? How can you tell? Which end of the sequence shown above is the 5’ end of the sequence being made via PCR.
Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…