In prokaryotes, a search for genes in a DNA sequenceinvolves scanning the DNA sequence for long openreading frames (that is, reading frames uninterruptedby stop codons). What problem can you see with thisapproach in eukaryotes?

In prokaryotes, a search for genes in a DNA sequenceinvolves scanning the DNA sequence for long openreading frames (that is, reading frames uninterruptedby stop codons). What problem can you see with thisapproach in eukaryotes?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 13P: Chemical Mutagenesis of DNA Bases Show the nucleotide sequence changes that might arise in a dsDNA...

See similar textbooks

Related questions

Q: The following sequence of nucleotides is found in a single-stranded DNA…

A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…

Q: Let’s say that a stretch of repeated AT issuccessfully sequenced. From what you know of the…

A: Sequence assembly involves the alignment and merging of fragments from a DNA (deoxyribonucleic acid)…

Q: Certain repeated sequences in eukaryotes are flanked by short direct repeats, suggesting that they…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than…

A: An intron is any nucleotide sequence within a gene that is removed by RNA splicing during maturation…

Q: Prokaryotic DNA is normally slightly negatively supercoiled, which can lead to "DNA breathing". How…

A: DNA breathing is defined as the short and temporary or in other words a transient opening of nucleic…

Q: Transcribe and translate the following DNA sequence (nontemplate strand);…

A: The gene is expressed into protein by the transcription and translation step.

Q: DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki…

A: The given statement is TRUE

Q: How often, on average, would you expect a type II restriction endonuclease to cut a DNA molecule if…

A: Restriction endonucleases are enzymes produced by bacteria that cut the DNA at a specific site known…

Q: The modular nature of eukaryotic activator proteinsgave scientists an idea for a way to find…

A: The function of the yeast two-hybrid system It is based on the fact that the activating and binding…

Q: The restriction endonuclease PstI cuts DNA symmetrically on both strands at the sequence: CTGCAG…

A: Restriction enzymes cleave the double-stranded DNA. Restriction enzymes cleave the double-stranded…

Q: The following sequence of nucleotides is found in a single-stranded DNA template:…

A: The process of formation of mRNA from DNA is called transcription.

Q: In the actual experiment, the researchers used 149 sequences to buildtheir sequence logo, which is…

A: The sequence logo helps in predicting certain gene features. Gene features such as the ribosome…

Q: Using this strand of DNA (TACAACTGA), show what a deletion and insertion would look like”

A: Nucleotides are subunits of DNA, and each nucleotide is made of a sugar molecule called deoxyribose,…

Q: a. Write the template DNA (complementary strand) sequence for the wild type gene above b. Write…

A: The coding strand is complementary to the template strand. The template strand is the DNA sequence…

Q: In reverse transcriptase polymerase chain reaction (RT-PCR), an analytical method used to amplify…

A: Reverse transcriptase polymerase chain reaction (RT-PCR) is a method used to amplify and sequence…

Q: The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs…

A: T7 RNA polymerase shares extensive sequence similarity with mitochondrial and chloroplast RNA…

Q: Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in.......

A: Solution - Variable number of tandem repeats (VNTRs) in the DNA molecule are highly useful in DNA…

Q: You obtain the DNA sequence of a mutant of a 2-kb gene in which you are interested and it shows base…

A: the mutation is the change or error that is caused in the chromosome it is of a different type 1.…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An exon is any part of a gene that will encode a part of the final mature RNA produced by that gene…

Q: The sequence of the 15 bp fragment from the previous problem is repeated below: 5' TCTGAATTCCGTAGA…

A: DNA is a double-stranded molecule that is made of several nitrogen base pairs. The nitrogen base of…

Q: Figure 25: MCS of PUC19 A. If the MCS were cut with Kpn I and BamH I, draw the small fragment of DNA…

A: pUC19 is a plasmid cloning vector developed by Joachim Messing. It is a 2686 base pair containing…

Q: The following DNA sequence is derived from the middle of an exon of a eukaryotic gene. This sequence…

A: The Central Dogma concept states that DNA is duplicated into DNA. RNA is formed from DNA and…

Q: In studies of frameshift mutations, Crick, Barnett, Brenner, andWatts–Tobin found that either three…

A: A frameshift mutation is a genetic mutation caused by insertions or deletions of a number of…

Q: Process by which the DNA sequences encoding exons are exchanged and reordered through genetic…

A: Exon :- the coding part of the gene. Intron :- the non coding regions of pre mature mRNa.

Q: . A mutational lesion results in a sequence containing amismatched base pair:5′ AGCTGCCTT 3′3′…

A: Mismatch repair : It is a system for recognizing and repairing wrong insertions, deletions and…

Q: How many possible open reading frames (frameswithout stop codons) exist that extend through the…

A: In molecular genetics, an open reading frame (ORF) is the part of a reading frame that has the…

Q: Posttranscriptional modifications include adding a 5’ cap and a 3’ tail removing a 5’ cap and a 3’…

A: The process by which the information contained in a strand of DNA is transcribed into a new molecule…

Q: The following sequence of nucleotides is found in a single-stranded DNA template:…

A: The process of formation of mRNA from DNA is called transcription.

Q: The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA ……

A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…

Q: Suppose that you would like to amplify the DNA sequence below by a PCR reaction. Design 8 nucleotide…

A: A primer is defined as the short single-stranded DNA sequence, required in the polymerase chain…

Q: Although RNA polymerase is a processive enzyme that remains attached to the DNA over long stretches…

A: RNA polymerase is an enzyme that assists in the transcription process by copying a DNA sequence into…

Q: The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If…

A: DNA sequencing is used to determine the exact arrangement of the nucleotide bases adenine (A),…

Q: The following sequence of nucleotides is found in a single-stranded DNA template:…

A: Transcription is a process through which the template strand of DNA transcribes into mRNA to carry…

Q: Transcribe the DNA strand given above to write the sequence of the mRNA strand in the 5’ to 3’…

A: According to Bartleby guidelines, we are required to attempt first three sub-parts in case of…

Q: Give the RNA molecule sequence transcribed from the following DNA sequence of a eukaryotic gene and…

A: DNA stands fo deoxyribonucleic acid. It is the genetic material.

Q: The RNA polymerase is only using one strand of DNA as a template, and only transcribes specific…

A: Introduction: DNA, also known as deoxyribonucleic acid, is the genetic material present in humans…

Q: Genetics Attached is a segment of DNA (doublestranded). Answer the following questions about the…

A: Open reading frame is a part of genetic material which is responsible for expressing itself in the…

Q: Below is a sequence of DNA.…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: What is the melting temp. of the following double-stranded DNA fragment…

A: Melting temperature of the DNA is the temperature at which half of the DNA becomes single stranded…

Q: list the RNA sequence transcribed from the DNA template sequence TTACACTTGCTTGAGAGTC

A: DNA is a double-stranded molecule that stores the genetic information in the form nucleotide…

Q: Consider the following DNA template: 5’-AAGAGGTTCCAATGCAGGCACTCACCAACTCTTAAATAAA-3’…

A: Of the two strands of DNA, the template strand or non-coding strand is used for transcribing an mRNA…

Q: In the Sanger (dideoxy) method for DNA sequencing, a small amount of a dideoxynucleotide…

A: DNA sequencing: It is the biochemical method used to determine the sequence of the nucleotide bases…

Q: A biochemist was able to sequence a DNA found in a human sample from humans who were first believed…

A: The DNA is a self-replicating structure formed of two strands. The DNA is formed of nucleotides. The…

Q: Would you expect to find nuclear localization sequences(NLSs) in the proteins that make up…

A: A nuclear localization sequence is an amino acid sequence that aids in protein transport (import)…

Q: The restriction endonuclease NotI recognizes the octanucleotide sequence GCGGCCGC. Calculate the…

A: restriction endonuclease is an enzyme that cuts DNA sequences at specific sites.

Q: The sequence shown below is the 5' to 3' strand of a dsDNA template. What are the sequences of the…

A: So, for choosing the primers for PCR, following requirements must be fulfilled :- 1. It should be…

Q: Digestion of a DNA sample with Decll, which is a “4-cutter" enzyme that produces blunt (rather than…

A: A 4-cutter restriction enzyme means the recognition sequence of the enzyme is a 4 bp sequence. It…

Q: Replicate this sense strand to create a double-stranded DNA helix…

A: DNA is the store house of general characteristic. The specific sequence of 4 bases in the DNA…

Question

In prokaryotes, a search for genes in a DNA sequence
involves scanning the DNA sequence for long open
reading frames (that is, reading frames uninterrupted
by stop codons). What problem can you see with this
approach in eukaryotes?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right.
Would you expect to find nuclear localization sequences(NLSs) in the proteins that make up prokaryotic and eukaryotic DNA and RNA polymerases? Explain why orwhy not
Below is a sequence of DNA. 5'-ttaccgataattctctctcccctcttccatgattctgattaaagaaggcgagaacgaaactatttgttaatacc-3' How many "reading frames" can be identified for this sequence? How many "open reading frames" can be identified for this sequence? What is the frame of the longest ORF?
The RNA polymerase from bacteriophage T7 diff ers structurally from prokaryotic and eukaryotic RNAPs and is extremely specifi c for its own promoter. Why do these properties make T7 RNAP useful in experiments with recombinant DNA?
Transcribe and translate the following DNA sequence (nontemplate strand); 5GCATGCGCGGCCATGTTGATTAAGCA 3Show and label the ends of your code for each step.
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Which end of the DNA template is 5′ and which end is 3′?
Below are several DNA sequences that are mutated compared with the wild-type sequence. Eachis a section of a DNA molecule that has separated in preparation for transcription, so you are onlyseeing the template strand. For each mutated DNA sequence, translate and record the resultingamino acid sequence. What type of mutation is each? Wild-type sequence: 3’-T A C T G A C T G A C G A T C-5’ Mutated DNA Template Strand #1: 3’-T A C T G T C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation: Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’Amino acid sequence of peptide:Type of mutation:
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.
In reversible terminator sequencing, how would the sequencing process be affected if the 3′-end-blocking group of each nucleotide were replaced with the 3′-H present in the dideoxynucleotides used in Sanger sequencing?
Below is a sequence of 540 bases from a genome. What information would you use to find the beginnings and ends of open reading frames? How many open reading frames can you find in this sequence? Which open reading frame is likely to represent a protein- coding sequence, and why? Which are probably not functioning protein-coding sequences, and why? Note: for simplicitys sake, analyze only this one strand of the DNA double helix, reading from left to right, so you will only be analyzing three of the six reading frames shown in Figure 19.4.
Transcribe and translate the following DNA sequence (nontemplate strand): 5’-ATGGCCGGTTATTAAGCA-3’
. You obtain the DNA sequence of a mutant of a 2-kb genein which you are interested and it shows base differencesat three positions, all in different codons. One is a silentchange, but the other two are missense changes (they encode new amino acids). How would you demonstratethat these changes are real mutations and not sequencing errors? (Assume that sequencing is about 99.9 percent accurate.)